Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for 6 Chloro 5 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 4’,6-diamidino-2- phenylindole (DAPI, Sigma, D9542) was diluted in the respective medium and added to the cultures at a final concentration of 10 ug/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... and eosin (Sigma HT110-2-3) for two minutes each ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or (2) Gill’s Haematoxylin #3 (Sigma), rinsed in 70% ethanol ...
-
bioRxiv - Cell Biology 2022Quote: ... β2/3 (Millipore, catalog #: 05-474), or γ2 (Synaptic Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... adenosine-2′,3′-dialdehyde (AdOx) (Sigma) or equal volume of DMSO vehicle was added to cells for 24 hours at a final concentration of 20 µM.
-
bioRxiv - Plant Biology 2022Quote: ... 1x phosphatase inhibitor cocktail 2 and 3 from Sigma) ...
-
bioRxiv - Developmental Biology 2024Quote: ... phosphatase inhibitors 2 and 3 (Sigma) and protease inhibitor cocktail (Complete ...
-
bioRxiv - Bioengineering 2021Quote: ... The secondary antibodies were washed away with PBS (3x 5 min) whereafter 4’,6-diamidino-2-phenylindole (DAPI, 1:500, Sigma) was added for 10 minutes to localize the cell nuclei ...
-
bioRxiv - Neuroscience 2021Quote: ... saline or 6-OHDA (5 μg/μL; 2 μL in total, at a rate of 0.5 μL/min, Sigma, Canada) were injected unilaterally in the dorsal striatum ...
-
bioRxiv - Neuroscience 2021Quote: ... nuclear labelling was achieved by incubating the sections for 5 min in DAPI (4′,6-diamidino-2-phenylindole; 1:5000; Sigma). Two final washes in PBS were performed before the sections were mounted on glass slides using Vectashield (Vector Laboratories ...
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (5 μM) and propidium iodide (PI) (50 μg/mL) (Sigma-Aldrich, St. Louis, USA) and incubated at room temperature for 30-60 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... cells were washed three times in PBS and mounted in 70% glycerol with with 5 μgml-1 concentration of 4-6-diamidino-2-phenylindole (DAPI, Sigma) and cells were mounted on cover slips ...
-
bioRxiv - Neuroscience 2019Quote: ... 5, 6 and 7 (days 52 to 55 in the overall timeline, Figure 2) at 100 mg/kg ip (Sigma), at approximately 17:00 hr ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were washed three times with 1x PBS and incubated for 5 minutes in 300 nM 4′,6-diamidino-2-phenylindole (Sigma) before a final 1x PBS wash ...
-
bioRxiv - Immunology 2020Quote: ... Cells were washed once with PBS prior incubation for 5 min at 37 °C with 4′,6-diamidino-2-phenylindole (DAPI; Sigma). Finally ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Chromosomes were stained with 4′,6-diamidino-2-phenylindole at a concentration of 5 μg/ml (DAPI; Sigma-Aldrich, D8417).
-
bioRxiv - Immunology 2024Quote: ... slides were washed in PBS and incubated in 5 μg mL-1 4’,6-diamidino-2-phenylindole (DAPI) (Sigma Aldrich) in PBS (Sigma Aldrich ...
-
bioRxiv - Plant Biology 2021Quote: ... The full length coding sequence of AdACS1/2/3 and AdACO3/5 were inserted into pET-32a (Novagen) vector and then transferred into Escherichia coli strain BL21 (DE3) ...
-
bioRxiv - Neuroscience 2022Quote: ... we delivered the Iκ-kinase inhibitor [5-(p-Fluorophenyl)-2-ureido]thiophene-3-carboxamide (TPCA-1; Sigma-Aldrich CAS 507475-17-4 ...
-
bioRxiv - Neuroscience 2023Quote: ... Larvae were incubated overnight from 4 dpf in 3 ml 10 mM 5-Bromo-2′-deoxyuridine (B5002, Sigma) with 1% DMSO for 17 hours ...
-
bioRxiv - Microbiology 2023Quote: ... After 24 hrs media/inhibitor was aspirated and replaced with 20 μl of 5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) (Sigma) and incubated at 37 °C in 5% CO2 for 3 hrs ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 μL MTT (5 mg/ml tetrazolium salt 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, Sigma-Aldrich) was added to each well and kept in a dark for 4 hours at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse VPS35 (5’-GAUUCGAGAAGAUCUCCCA[dT][dT]-3’&5’-GUAAUGUUCUGGAUUAUAA[dT][dT]-3’) were purchased from Sigma-Aldrich. At 24 h after transfection ...
-
bioRxiv - Bioengineering 2019Quote: ... Clean coverslips were silanized by exposure to trichloro(1H,1H,2H,2H-perfluorooctyl)silane (TCPFOS) (Sigma-Aldrich) vapors under vacuum for 24 hours ...
-
bioRxiv - Bioengineering 2020Quote: ... Next, the mold was placed under vacuum with trichloro (1H, 1H, 2H, 2H-perfluoro-octyl) silane (Sigma) for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... 1H,1H,2H,2H-Perfluorodecanethiol (97%) and α,α,α-trifluorotoluene (99%) were obtained from Sigma Aldrich Co ...
-
bioRxiv - Bioengineering 2022Quote: ... Wells were passivated overnight using vapor deposition of Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma 448931) and sterilized with 70% (v/v ...
-
bioRxiv - Biochemistry 2022Quote: ... Channels were made hydrophobic by flushing of 1% trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma-Aldrich) in HFE-7500 (3M Novec) ...
-
bioRxiv - Microbiology 2023Quote: ... The channels were filled with 1 % v/v trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma-Aldrich) in HFE-7500 fluorinated oil (3M Novec Engineered fluid ...
-
bioRxiv - Biophysics 2023Quote: ... the mold was treated once with silane Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (448931, Sigma-Aldrich) to prevent the PDMS from sticking and subsequently damaging the constrictions ...
-
bioRxiv - Neuroscience 2023Quote: ... The sections were then dehydrated in ascending concentrations of ethanol for 5 min each (2[×[35%, 50%, 70%, 80%, 90%, 3[×[100%) and washed 3 times for 5 min with propylene oxide (Sigma-Aldrich, #cat 110205-18L-C). Next ...
-
bioRxiv - Microbiology 2020Quote: ... A precipitating chromogenic substrate (4- Chloro-1-Naphthol; C6788, Sigma-Aldrich) was added.
-
bioRxiv - Plant Biology 2019Quote: ... and 0.5 mg/mL 5(6)-Carboxyfluorescein diacetate (Sigma) was applied to the cut using a P2 pipette ...
-
bioRxiv - Biophysics 2021Quote: ... and 5(6)-carboxyfluorescein were purchased from Sigma-Aldrich. Methanol (LC/MS grade ...
-
bioRxiv - Biochemistry 2021Quote: ... G6PD (1M 6-aminonicotinamide, Sigma, Cat#329-89-5), PKM (20μM Compound 3K ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 μM 6-azauridine (catalogue no. A1888; Sigma-Aldrich), 5 μM HCQ (catalogue no ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-UCGUGGAAAGUUUGCUGCAGGGAAA[dT][dT]-3’ (Sigma) (Doucet et al. ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Developmental Biology 2019Quote: ... and 5 mM 3-MA (M9281, Sigma), respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Cell Biology 2020Quote: ... were blocked for 1h in TBS containing 0.1% Tween-20 (TBS-T) supplemented by 3% fatty-acid free BSA (Sigma Aldrich) before incubation with the purified STARD10 protein (1 μg/mL in TBS-T + 3% BSA ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Developmental Biology 2021Quote: Larvae at 2-6 dpf were first anesthetized with 0.03 % Ethyl 3-aminobenzoate methane sulfonate salt (Sigma-Aldrich, St. Louis, MO, USA) and pinned onto a Sylgard-filled recording chamber (I-2450 ...
-
bioRxiv - Microbiology 2021Quote: ... containing 5% 2-mercaptoethanl (Sigma) by incubating the beads at 100°C for 5 min ...