Labshake search
Citations for Millipore Sigma :
751 - 800 of 10000+ citations for 6 Chloro 5 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... containing 5% 2-mercaptoethanol (Sigma) and fractionated by SDS-PAGE using the Mini-PROTEAN Tetra System (Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol (Sigma), and incubated at room temperature instead of boiled ...
-
bioRxiv - Cancer Biology 2019Quote: ... Complementary oligonucleotides 5’-CACCG AGCTT GGCCC GCTTG CGGCG-3’ and 5’-AAACC GCCGC AAGCG GGCCA AGCTC-3’ (Sigma-Genosys) were annealed and ligated into the BbsI-digested restriction endonuclease site of pSpCas9(BB)-2A-Puro plasmid (gift from Dr ...
-
bioRxiv - Cell Biology 2020Quote: ... AKAP220 siRNA (5’-CCAAUGUAAGCA GUAGUCCUCUAA A-3’) and scramble siRNA (5’-UUUAGAGGACUACUGCUUACA UUGG-3’) were from Millipore (Burlington, MA).
-
bioRxiv - Biochemistry 2020Quote: ... Sequences for the HIF1α shRNA (shRNA10819 5’-CCGGTGCTCTTTGTGGTTGGATCTACTCGAGTAGATCCAACCACAAAGAGCATTTTT-3’ and shRNA3809 5’-CCGGCCAGTTATGATTGTGAAGTTACTCGAGTAACTTCACAATCATAACTGGTTTTT-3’) were obtained from Sigma Aldrich. Scrambled shRNA was used as negative controls ...
-
bioRxiv - Microbiology 2019Quote: ... With primers comprising the respective restrictions sites (underlined) (F: 5’-3’ TGCAGACATATGAACCCCAACCACTCTG. R: 5’-3’ TACTAGAATTCCTAGACGCTCGATGTCGCC, Sigma-Aldrich, Germany), the full ORF was amplified from pCC2FOS-Mm3 by a standard PCR reaction using the Phusion DNA polymerase (New England BioLabs ...
-
bioRxiv - Molecular Biology 2023Quote: ... two siRNAs targeting this RBP (siPTBP1) were transfected into HeLa cells (siPTBP1_1: 5’-GCACAGUGUUGAAGAUCAU-3’; siPTBP1_2: 5’-AACUUCCAUCAUUCCAGAGAA-3’; Sigma-Aldrich), using the jetPRIME® (Polyplus Transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’CGUACGCGGAAUACUUCGA[dU][dU]3’) and Cofilin-1 (5’CCUCUAUGAUGCAACCUAU[dU][dU]3’)[78] have been synthetized by Sigma. In rescue experiments ...
-
bioRxiv - Microbiology 2022Quote: 7 mmol ABTS (2,2’-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid, Sigma) stock solution was mixed with 2.45 mmol potassium persulfate (K2S2O8 ...
-
bioRxiv - Genomics 2023Quote: ... with 3 μg of 6-OHDA in 0.01% ascorbate (Sigma–Aldrich) into the median forebrain bundle (MFB ...
-
bioRxiv - Neuroscience 2023Quote: ... 2,2’-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS, Sigma-Aldrich) substrate was added to each well ...
-
bioRxiv - Neuroscience 2021Quote: ... washed 3 times for 5 min with PBS and permeabilized for 1h at room temperature (permeabilization buffer: 2,5% donkey serum (Sigma), 1% BSA ...
-
bioRxiv - Physiology 2020Quote: ... Slides were then washed twice in warm water for 5 min and stained for 1h at RT with Picro-Sirius Red solution (0.1% (m/v) Sirius Red (Sigma) in saturated aqueous solution of Picric Acid (LabChem)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the zebrafish larvae were permeabilized for 1h at RT with a blocking buffer [5% BSA (A9647-10G, Sigma-Aldrich), 5% sheep serum (013-000-1210 ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were blocked with 5% normal donkey serum for 1h at room temperature and incubated with Nissl (1:2000, in 0.1M PB, Sigma) for 30 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... and then it was silanized by incubating with Trichloro (1H,1H,2H,2H-perfluoro-octyl) silane (Sigma, 448931). To make 1st PDMS ...
-
bioRxiv - Cell Biology 2021Quote: ... After silanizing the surface of the PDMS pillars with Trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Sigma, 448931) overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... the wafer was coated with a layer of Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (FOTS, Sigma-Aldrich). Polydimethylsiloxane (PDMS ...
-
bioRxiv - Cell Biology 2019Quote: ... passivated overnight at low pressure with a solution of Trichloro(1H,1H,2H,2H-perfluorooctyl)-silane (Sigma, 448931).
-
bioRxiv - Immunology 2023Quote: ... microfluidic channels were flushed with 1% (v/v) trichloro(1H,1H,2H,2H-perfluoro-octyl)silane (Sigma-Aldrich) in HFE-7500 (3M Novec ...
-
bioRxiv - Cell Biology 2023Quote: ... After silanizing the surface of the PDMS pillars with Trichloro (1H,1H,2H,2H-perfluorooctyl) silane (Sigma, 448,931) overnight ...
-
bioRxiv - Bioengineering 2023Quote: ... molds surfaces were coated with trichloro(1H,1H,2H,2H-perfluorooctyl) silane (Sigma-Aldrich, St. Louis, MO, USA). A Sylgard 184 PDMS two-part elastomer (ratio of 10:1 pre-polymer to curing agent ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μM 5-bromo-2’-deoxyuridine (BrdU, Sigma-Aldrich) was added into the culture medium for 10 h ...
-
bioRxiv - Genomics 2020Quote: ... 5-aza-2’-deoxycytidine (5-aza-dC, Sigma, A3656) was diluted in DMSO at a concentration of 10mM and Abl.1 cells were treated using a concentration range of 10 nM to 20 μM 5-aza-2’-deoxycytidine ...
-
bioRxiv - Neuroscience 2020Quote: ... The neuronal damage was examined by staining with Fluoro-Jade B (Millipore) according to the method of Schmued et al (39).
-
bioRxiv - Neuroscience 2020Quote: ... and 1-Fluoro-2,4-dinitrobenzene (Catalog: D1529) were obtained from Sigma Aldrich. CTOP (Catalog ...
-
bioRxiv - Neuroscience 2019Quote: ... and were then transferred to the Fluoro-Jade (Sigma, St. Louis, EUA) staining solution for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then incubated in 0.001% Fluoro JadeB (Sigma Aldrich Cat# AG310) for 20 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... free floating sections were stained for ChAT (Primary: ChAT Fluoro Stain, Millipore ab144p ...
-
bioRxiv - Bioengineering 2020Quote: ... gels were fabricated with a final concentration of 1×105 AFC/mL (P3-5) and incubated in EGM-2 +/- 1 mg/mL of the plasmin inhibitor 6-aminocaproic acid (Sigma, A2504) at 37°C and 5% CO2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a freshly prepared solution of 5-(6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA; Sigma-Aldrich Co., St. Louis, MO, USA) in DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... was used diluted at 4 μg/mL in PBS and incubated for 30 min with 5 μg/mL 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS to stain nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... The cells were centrifuged for 5 min at 700g and treated for 10 min with DAPI (4’,6-diamidino-2-phenylindole) (1:4000, Sigma, 62248) to label dead cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cryosections were then counterstained (5 min) with 0.5 µg/ml 4’,6’-diamino-2-phenylindole (DAPI; Sigma-Aldrich® Cat#D9542) in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... counter-stained with 4’,6-diamidino-2-phenylindole (DAPI) for 5 minutes at room temperature and mounted with Fluoroshield (Sigma-Aldrich).
-
bioRxiv - Molecular Biology 2022Quote: ... The cells were washed in PBS and stained with 5 µg/ml 4′,6-Diamidino-2- phenylindole (DAPI) (D9564-10MG, Sigma-Aldrich) in 1xPBS+0.1% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: ... nuclei and actin were stained in PBST containing 5 µg/ml 4′,6-diamidino-2– phenylindole dihydrochloride (DAPI; D9542, Sigma-Aldrich) and Alexa Fluor 488 phalloidin (diluted in 1/100 ...
-
bioRxiv - Neuroscience 2023Quote: ... The cells were then centrifuged at 200 rcf for 5 min and resuspended at a density of 2×105 cells/ml in ultra-low attachment 6-well plates (Sigma, CLS3471) using N2B27 medium (50% Advanced DMEM/F12 (ThermoFisher ...
-
bioRxiv - Physiology 2020Quote: The reduction of yellow tetrazolium salt 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; Sigma-Aldrich, Germany) was used to measure cellular metabolic activity as a proxy for cell viability [19,22] ...
-
bioRxiv - Cancer Biology 2021Quote: ... migrating/invading/transmigrating cells were incubated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 5 mg/ml, 1/10 volume; Sigma-Aldrich) added to the culture medium at 37°C for 4h ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, San Louis, MI, USA) solution in PBS was added to the cells and incubated for an additional 4 h ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were incubated with 5 mg/mL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma Aldrich) in PBS for 15 min at 37 °C ...
-
bioRxiv - Cancer Biology 2021Quote: ... migrating/invading cells were incubated with 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 5 mg/ml, 1/10 volume; Sigma-Aldrich) added to the culture medium at 37°C for 4h ...
-
bioRxiv - Microbiology 2022Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was applied to the cells and incubated for an additional 4h ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mg/ml of 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich, St. Louis, MI, USA) solution was added to the cells and incubated for an additional 4 h ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... media was aspirated from cells and replaced with 5 mg/mL 3-(4,5-Dimethyl-2-thiazolyl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, #M5655, Sigma Aldrich) solution in base media ...
-
bioRxiv - Cell Biology 2023Quote: The cell proliferation assay was determined by 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT) assay (Sigma). All cancer cell lines were seeded in 24-well plates (2×104 cells/well) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Fixed embryos were washed 3 times (5 minutes each) in wash buffer DPBS Tween containing 2% BSA (Sigma, A3311), and permeabilised at room temperature for 20 minutes in permeabilisation buffer 0.5% Triton-X in DPBS ...
-
bioRxiv - Cancer Biology 2023Quote: Culture medium was replaced with 100 µL medium containing 5 mg/mL filtered 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (#M5655, Sigma-Aldrich) and incubated for 2 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 30 μL of MTT [(3- [4,5-dimethyl-2-thiazolyl] -2,5-diphenyl-2H-tetrazolium bromide; 5 mg/mL; (Sigma-Aldrich)] was added in each well and the plate incubated for 3 hours at 25°C ...