Labshake search
Citations for Millipore Sigma :
501 - 550 of 10000+ citations for 6 Chloro 5 fluoro 1H indole 2 3 dione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI) (Sigma). For immunofluorescence staining primary antibodies were anti-luciferase antibody (ab21176 Abcam ...
-
bioRxiv - Cell Biology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma) was used to eliminate dead cells ...
-
bioRxiv - Cell Biology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Sigma) was used to eliminate dead cells ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma) and Alexa488 Streptavidin (Thermo Fisher ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma). Flow cytometry was performed on a MACSQuant Analyzer 10 (Miltenyi Biotec) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma). Slides were mounted with Elvanol mounting medium.
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamino-2-phenylindole (DAPI) (Sigma) in PBS for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Sigma) or fixable viability dye 405 (eBiosciences) ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride; 5 µg/ml, Sigma-Aldrich) at room temperature for 20 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... Sections were mounted after 4′,6-diamidino-2-phenylindole (DAPI) staining (1:5 000, Sigma-Aldrich, USA). Confocal images were captured under 20× objective using A-1R Confocal Microscope (Nikon ...
-
bioRxiv - Developmental Biology 2022Quote: ... and (+−)-6-hydroxy-2,5,7,8- tetra- methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Potassium chloride (cat ...
-
bioRxiv - Cell Biology 2023Quote: ... the DNA was stained with 5 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, D9542-5MG, SIGMA) diluted in 2% bovine serum albumin (BSA ...
-
bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. Sodium hydroxide (cat ...
-
VPS13B is localized at the cis-trans Golgi complex interface and is a functional partner of FAM177A1bioRxiv - Cell Biology 2023Quote: ... and (+−)-6-hydroxy-2,5,7,8-tetra-methylchromane-2-carboxylic acid (Trolox) (cat: 238813-5 G) were ordered from Sigma. 1× Phosphate Buffered Saline (PBS ...
-
bioRxiv - Genomics 2019Quote: ... with primers 5’ GAGCTGGACGGCGACGTAAACG 3’ and 5’ CGCTTCTCGTTGGGGTCTTTGCT 3’ for amplification (Sigma-Aldrich, Germany). The PCR amplification was as follows ...
-
bioRxiv - Microbiology 2020Quote: ... The mould was treated with Trichloro(1H,1H,2H,2H perfluorooctyl)silane (Sigma) in vacuum overnight ...
-
bioRxiv - Cell Biology 2020Quote: ... and subsequently with 1H,1H,2H,2H-perfluoro-1-octanol (PFO, Sigma-Aldrich) to destabilise the droplet interface and break the emulsion ...
-
bioRxiv - Biophysics 2021Quote: ... After exposure to vapor of trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma) for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Next, a treatment of trichloro (1H, 1H, 2H, 2H-perfluorooctyl)silane (Millipore Sigma) was applied to the surface of the 3D piece to make it inert and to facilitate the next step of casting ...
-
bioRxiv - Neuroscience 2021Quote: Fluoro Jade B (FJB; Cat#AG310, Millipore, Billerica, MA) labeling was performed in an adapted accordance to Noll et al ...
-
bioRxiv - Cell Biology 2021Quote: ... were reared in 10g/l of glucose/200µM of 3BDO (3-Benzyl-5-((2-nitrophenoxy) methyl)-dihydrofuran-2(3H)-one) (Sigma Aldrich) supplemented in standard fly food ...
-
bioRxiv - Neuroscience 2019Quote: ... after which 10 μM 6-TG (6-thioguanine or 2- amino-6-mercaptopurine, Sigma-Aldrich) with 200 μg/ml G418 selection was carried out for an additional 6-8 days ...
-
bioRxiv - Cell Biology 2019Quote: ... Some PAs were treated with XE991 (3·10-8-3·10-6, Sigma) before the stimulation with 5-HT and then the relaxation induced by SNP was tested.
-
bioRxiv - Molecular Biology 2023Quote: ... siZWINT (Sigma, 5’-GCACGUAGAGGCCAUCAAA-3’). RNAiMAX (Invitrogen ...
-
bioRxiv - Biochemistry 2019Quote: ... 3 µl 16 mM Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (TBTA) (Sigma-Aldrich) prepared in 20% DMSO and 80% t-butanol (Sigma) ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 μL of 1× ligand (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Sigma-Aldrich) 20% DMSO in t-butanol) ...
-
bioRxiv - Systems Biology 2023Quote: ... Sections were then blocked for 1h with 3% (v/v) donkey serum (Sigma-Aldrich, St Louis, MO) diluted in TBS-T wash buffer ...
-
bioRxiv - Microbiology 2022Quote: ... 5(6)-carboxyfluorescein (CF) was from Sigma. EM104 10ml glass syringes from Sanitex international.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Three more washing steps with TBS were performed before resolving the staining with 5 ml of substrate per membrane: a 30 mg tablet of 4-chloro-1-naphthol (Sigma) dissolved in 10 ml of methanol ...
-
bioRxiv - Cancer Biology 2023Quote: ... staining solution (0.3 mg/ml of 5-bromo4-chloro-3indolyl β-D-galactoside, X-Gal Fermentas R0401, 40 mM citric acid, Sigma C-0759 ...
-
bioRxiv - Neuroscience 2022Quote: ... CAS# 83-34-1), indole (98%, CAS# 120-72- 9), and 3-ethylindole (97%, CAS# 1484-19-1) were provided by Sigma-Aldrich (Milwaukee, WI), ACROS Organics (Geel ...
-
bioRxiv - Cell Biology 2022Quote: ... Strains containing AID tag alleles were treated with final concentrations of 250 µM 3-indole acetic acid (Sigma-Aldrich, St. Louis, MO, USA) in DMSO and buffered with 50 mM potassium phosphate buffer at pH 6.2 for the 30 minutes prior to harvesting or imaging ...
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... flies were collected 2-5 days post eclosion and grown for another 3-5 days on 1mM all-trans retinal (R2500; Sigma-Aldrich) supplemented food in complete darkness before experimental testing was performed ...
-
bioRxiv - Microbiology 2022Quote: ... 100 μl of 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT, 0.5 mg/ml in PBS, Sigma-Aldrich, USA) with 1 μM of menadione (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by a blocking step for 1h with 5% normal donkey serum (NDS) (D9663, Sigma Aldrich) in 0.1% PBS-Triton X-100 (PBS-T) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2023Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′- TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous reference (PPIA ...
-
Micro topographical instruction of bacterial attachment, biofilm formation and in vivo host responsebioRxiv - Microbiology 2022Quote: ... A mould fluorosilane release agent, trichloro (1H, 1H, 2H, 2H-perfluorooctyl) silane (Sigma Aldrich) was applied using vapour deposition ...
-
bioRxiv - Bioengineering 2022Quote: ... and coated with trichloro[1H,1H,2H,2H-perfluorooctyl]silane (Sigma-Aldrich, Catalog 448931).
-
bioRxiv - Cell Biology 2019Quote: ... the master mold was silanized with trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma) for easier lift-off ...
-
bioRxiv - Microbiology 2021Quote: ... collected droplets were broken with 1H,1H,2H,2H-perfluoro-1-octanol (Sigma-Aldrich) to collect beads ...
-
bioRxiv - Microbiology 2022Quote: ... and subsequently treated overnight with Trichloro(1H,1H,2H,2H-perfluorooctyl)silane (Sigma 448931). The next day ...
-
bioRxiv - Cell Biology 2020Quote: ... The emulsion was broken with 1H,1H,2H,2H-Perfluoro-1-octanol (Sigma Aldrich) and the beads washed three times in TBEST ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 mL of 20% PFO (1H,1H,2H,2H-perfluoro-1-octanol, Sigma, 370533) and 5 mL of PBST buffer (0.4% tween 20 in PBS ...
-
bioRxiv - Immunology 2021Quote: Blood was extracted from hBLT mice at 3 and 5-6 weeks post-infection and lysed with Red Blood Cell Lysis Buffer (SIGMA). T cells were activated for 1.5 h with 5μl/ml of anti-CD28 and anti-CD49d in the presence or absence of 6.4μg/ml of a Gag pool of peptides in the presence of 0.5μg/ml Brefeldin A ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then treated with 6-thio-dG (3-5 μM) in the presence of 500 ng/ml doxycycline (Sigma), washed three times with warm PBS and allowed to recover in regular growth medium containing 500 ng/ml doxycycline ...
-
bioRxiv - Neuroscience 2022Quote: ... mito-tempol[23] (25 μg, Sanbio) and oligodeoxynucleotide (3 μg/μl day 4, 5 and 6 after carrageenan, Sigma-Aldrich), were performed under light isoflurane anesthesia as described.[8a ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Genetics 2019Quote: BzATP (2′(3′)-O-(4-Benzoylbenzoyl) adenosine 5′-triphosphate triethylammonium salt) was purchased from Millipore Sigma and ...