Labshake search
Citations for Millipore Sigma :
701 - 750 of 10000+ citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Bands were stained in 5-bromo-4-chloro-3-indolyl-phosphate and nitro blue tetrazolium solution (Sigma-Aldrich). The membrane image was acquired using a digital steel camera EOS M6 mark II with a lens EF16-35 mm F4L IS USM (Canon Inc. ...
-
bioRxiv - Bioengineering 2020Quote: ... were added to 1 mL of a 0.1M solution of 5-norbornene-2-carboxylic acid in 0.1M phosphate buffer (pH 6.0) (all reagents purchased from Sigma-Aldrich). The solution was allowed to react at room temperature with intermittent vortexing ...
-
bioRxiv - Cell Biology 2020Quote: ... the hSCOs were either cultured in DM containing AEDs (valproic acid, 0.5 or 1 or 2 mM, Sigma, P4543; carbamazepine, 5 or 50 or 100 μM, Sigma, C4024 ...
-
bioRxiv - Neuroscience 2022Quote: ... and NMDA receptor mediated PSCs were blocked with DL-2-amino-5-phosphonopentanoic acid (D-AP5; 50 μM; Sigma). The AMPA-R PSC frequency and amplitude was determined from a 1 min interval after the recording had stabilized (~10 min after wash-in of picrotoxin/D-AP5) ...
-
bioRxiv - Bioengineering 2023Quote: ... Di-tert-butyl decarbonate (BoC2O) and 5-norbornene-2-carboxylic acid were purchased from Sigma Aldrich (St. Louis, MO). Irgacure 2959 was purchased from Advanced Biomatrix (Carlsbad ...
-
bioRxiv - Cell Biology 2024Quote: ... consisting of 1% FBS and gluMax along with 5 μM CHIR99021 and 2 μM retinoic acid (R2625, Sigma-Aldrich) for 72 hrs ...
-
bioRxiv - Neuroscience 2024Quote: ... and then in 0.175 M sodium acetate (14.36 mg/ml in ddH2O, pH 6.8, adjusted with glacial acetic acid, 2 × 5 min; Cat# S8750, Sigma-Aldrich). Sections were reacted in 0.5 mg/ml 3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μM 4-hydroxy tamoxifen (4-HT; Sigma) was added at the time of activation.
-
bioRxiv - Microbiology 2023Quote: ... 5 × 10−5 M 2-mercaptoethanol (Sigma), and 1% penicillin-streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... alpha-cyano-4-hydroxycinnamic acid (CHCA) and Trifluoroacetic acid (TFA) were purchased from Sigma-Aldrich. Histological-grade xylenes was purchased from Spectrum Chemical ...
-
bioRxiv - Pathology 2022Quote: ... Day 7 differentiated WT and ABHD4 KO 3T3-L1 adipocytes were labeled with 0.5 μCi [14C]-acetic acid or 5 μCi [3H]-oleic acid plus 0.04 mM oleic acid (Sigma-Aldrich) conjugated with 0.01 mM fatty acid free-bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2023Quote: ... Crypts were treated from seeding on with 3-hydroxyanthranilic acid (3-HAA; 200µM; Sigma-Aldrich).
-
bioRxiv - Cell Biology 2020Quote: ... 5 μl benzonase (Millipore, 71206-3) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’, Sigma Aldrich). The siRNA for luciferase (siLuc ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’, Sigma Aldrich), siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB8A (5’-GACAAGUUUCCAAGGAACGtt-3’, Sigma Aldrich), siRAB8B (5’-GACAAGUGUCAAAAGAAAGtt-3’ ...
-
bioRxiv - Cell Biology 2022Quote: ... siRAB11A (5’-UGUCAGACAGACGCGAAAAtt-3’, Sigma Aldrich), siRAB11B (5’-GCACCUGACCUAUGAGAACtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or Tim29 (5’ GGCUCUUCGAUGAGAAGUA 3’) (Sigma). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... with 3 mg 5-fluorouracil (Sigma). Bone marrow was collected after 4 days and cultured in DMEM containing 15% FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... or 5 mM 3-MA (Sigma) were added during the 16-h incubation period ...
-
bioRxiv - Cancer Biology 2023Quote: ... siTTLL12_6: 5’- GGUUGUUCGUGUAUGAUGU-3’ (Sigma-Proligo).
-
bioRxiv - Biochemistry 2024Quote: ... K125E reverse: 5’-ttcgatgcggacctcctgggttttgatctc-3’ (Sigma) with the wild-type human connexin 26 pFast construct used for previous studies as the template for mutagenesis (Brotherton et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... siSpindly (Sigma-Aldrich, 5′-GAAAGGGUCUCAAACUGAA-3′) for 48 h ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-H (Sigma, 5′-CUAGUGUGCUCAUGGAUAA-3′) (64) ...
-
bioRxiv - Biochemistry 2024Quote: ... siCENP-I (Sigma, 5′-AAGCAACTCGAAGAACATCTC-3′) (107) ...
-
bioRxiv - Microbiology 2024Quote: ... Rev: 5’ TGTCCGTGAGCCTTCCTGTTTCCCACAGCGTCC 3’ (Sigma-Aldrich). RNA was generated from linearized DNA by in vitro transcription and transfected into BHK21 cells using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and CTNNB1: 5’- CUCAGAUGGUGUCUGCUAU-3’ (Sigma). A complete list of antibodies is provided in Supplemental Table 2.
-
bioRxiv - Cell Biology 2024Quote: ... human ZBP1: 5’-CGGTAAATCGTCCATGCTT-3’ (Sigma). The gRNAs were cloned into pSpCas9n(BB)-2A-GFP plasmid (PX461 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 ng/mL interleukin-4 (IL-4, Sigma-Aldrich) and 0.5 μg/mL anti-CD180 (BD PharMingen) ...
-
bioRxiv - Physiology 2024Quote: ... samples were incubated with 5 µg/mL 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI, Sigma-Aldrich) in PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... samples were incubated for 5 min with a 4’,6-diamidino-2-phenylindole (DAPI) solution (Sigma) to stain cell nuclei ...
-
bioRxiv - Immunology 2021Quote: The livers of freshly-sacrificed mice were perfused retrogradely via the IVC(3) with 3 ml of PBS and then 10 ml of 2% paraformaldehyde (Sigma, catalogue# 30525-89-4) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: When the tumor sizes reached to 80 mm3 animals were treated with a PFKFB3 inhibitor 3-(3-pyridinyl)-1-(4-pyridinyl)-2-propen-1-one) (3PO) (Sigma-Aldrich, Merck, Overijse, Belgium). The animals received intraperitoneal (i.p. ...
-
bioRxiv - Plant Biology 2021Quote: ... lapachol (2-hydroxy-3-(3-methyl-2-butenyl)-1,4-naphthoquinone) were purchased from Sigma-Aldrich. Vismione H and madagascine were obtained from PGE2 fraction of Psorospermum glaberimum as previously described (Gallé ...
-
bioRxiv - Bioengineering 2022Quote: ... tissues were washed with 4% deoxycholic acid (Sigma-Aldrich) (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... after fixation in 4% trichloroacetic acid (Sigma-Aldrich, T9159) (44) ...
-
bioRxiv - Cell Biology 2020Quote: ... MALDI matrix α-cyano-4-hydroxycinnamic acid (CHCA, Sigma; 50% acetonitrile/0.1% trifluoroacetic acid ...
-
bioRxiv - Microbiology 2023Quote: ... and 4-bromobenzoic acid were obtained from Sigma-Aldrich. High crystallinity PET film (ES301250 ...
-
bioRxiv - Biochemistry 2024Quote: ... and 4-methylumbelliferone-N-acetyl-neuraminic acid (Sigma-Aldrich) at a final concentration of 250 µM in 25 mM sodium acetate buffer ...
-
bioRxiv - Microbiology 2024Quote: ... 4 g/L succinic acid (Sigma-Aldrich Ref: S3674) and pH was adjusted to 7.0 by using NaOH ...
-
bioRxiv - Immunology 2024Quote: ... 4-aminobenzoic acid hydrazide (ABAH, Sigma-Aldrich, A41909-10G), or diphenyleneiodonium chloride (DPI ...
-
bioRxiv - Immunology 2024Quote: ... 5 mM 2-hydrocycitrate (2-HC) (Sigma) was added to cell culture at indicated time points ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Neuroscience 2024Quote: ... 8-cyclopentyl-1,3-dimethylxanthine (CPT; 3 nmol in 5 μl saline of 2% DMSO; #C102; Sigma-Aldrich; injection was given immediately before the start of exposure to restraint stress or 30 min before intrathecal injection of NA).
-
bioRxiv - Microbiology 2022Quote: ... 3 days post-infection 4 mL of paraformaldehyde 4% (#158127, Sigma) was added and incubated overnight at 4ºC ...
-
bioRxiv - Microbiology 2021Quote: ... individuals were placed in a microtube containing in 100 µl of either Schneider’s media (Experimental Replicates 1 and 2) or RPMI media (Experimental Replicates 3 and 4) to which 2% Penicillin/Streptomycin and Amphotericin B (Sigma-Aldrich, Dorset, UK) had been added ...
-
bioRxiv - Cell Biology 2020Quote: ... NRCMs with serum-free DMEM no glucose media and ARCMs with serum-free media 199 for 16 h before treating with 4-methyl 2-oxopentanoic acid sodium salt (ketoleucine, Sigma), sodium-3-methyl-2-oxobutyrate (ketovaline ...
-
bioRxiv - Immunology 2020Quote: ... siLP cells were released by digestion of the tissue with RPMI/4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) supplemented with 60 μg/ml DNaseI (Sigma), and 400 ng/ml of Liberase (Roche Applied Science ...
-
bioRxiv - Microbiology 2021Quote: ... The bacterial pellet was re-suspended in ice-cold 100 mM HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulphonic acid) buffer (pH 8.0) containing complete protease inhibitor cocktail (Sigma, USA) and PMSF (phenylmethanesulphonyl fluoride ...