Labshake search
Citations for Millipore Sigma :
901 - 950 of 10000+ citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... 4 µM 1-Oleoyl lysophosphatidic acid sodium (LPA; Sigma, L7260), 10 ng/ml recombinant human LIF and 10 μΜ Y27632 ...
-
bioRxiv - Biophysics 2023Quote: ... 450 µM Thiol-dPEG®4-acid (Sigma-Aldrich QBD10247) and 250 µM TCEP-HCl (tris(2-carboxyethyl)phosphine-HCl ...
-
bioRxiv - Developmental Biology 2023Quote: ... and 1X 10-4 M retinoic acid (RA) (Sigma, R2625), then washed in 1X Steinberg’s solution ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... We mixed the resulting peptides with a MALDI matrix consisting of an aqueous 50% acetonitrile/0.1% TFA solution of α-cyano-4-hydroxycinnamic acid (5 mg/ml; Sigma-Aldrich, www.sigmaaldrich.com). We measured mass spectra using an Ultraflex III MALDI-TOF (Bruker Daltonics ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 5 µl of the sample solution was mixed with 5 µl of a saturated solution of α-cyano-4-hydroxycinnamic acid matrix for MALDI-MS (Sigma-Aldrich) in acetonitrile ...
-
bioRxiv - Immunology 2021Quote: ... or 3-MA (5 mM, Sigma-Aldrich), as indicated in the figure legends ...
-
bioRxiv - Neuroscience 2021Quote: ... and the following primers (Sigma, 5′-3′): 18S F ...
-
bioRxiv - Cell Biology 2021Quote: ... A luciferase oligo (5’-CGUACGCGGAAUACUUCGAdTdT-3’, Sigma) was used for control (Ctrl).
-
bioRxiv - Biochemistry 2021Quote: ... 5(6)-carboxyfluorescein (3 eq, Sigma-Aldrich) was activated with PyAOP (3 eq ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GGCCTCACTAAACCATCCAA-3’ were obtained from Sigma. Data were normalized to 18s and analysed using the 2-ΔΔCt method.
-
bioRxiv - Cancer Biology 2023Quote: ... 3- AP (0, 5 μM; Sigma, #SML0568), or Gemcitabine (0 ...
-
bioRxiv - Microbiology 2023Quote: ... and 5’- CCCAGAUAAGAUUUGUGAC-3’ (Millipore Sigma, SASI_Hs01_00041617), respectively ...
-
bioRxiv - Microbiology 2024Quote: ... 3-Methyladenine (5 mM, Millipore Sigma, M9281), lactostatin (1 µM ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... followed by five minutes in 2% peracetic acid (Supelco, Denmark: Cas number: 79-21-0) and a rinse in 5 mL sterile water (Sigma-Aldrich, Germany, Cas number: 7732-18-5) as per the protocol by Tegtmeier et al ...
-
bioRxiv - Cell Biology 2021Quote: A 10 mM oleic acid stock solution was made in 3 mM fatty acid–free BSA (Millipore-Sigma)-PBS ...
-
bioRxiv - Cell Biology 2021Quote: A 10 mM oleic acid stock solution was made in 3 mM fatty acid–free BSA (Millipore-Sigma)-PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... followed by treatment with 500 µM auxin (3-Indoleacetic acid; Sigma) for 5-6 hrs.
-
bioRxiv - Molecular Biology 2021Quote: ... 1mg/mL of Indole-3-acetic acid (Sigma, I3750-5G-A) was added ...
-
bioRxiv - Biophysics 2020Quote: ... Membrane strips were blocked with 3% fatty acid-free BSA (Sigma) in 20 mM Tris-HCl (pH 8.0) ...
-
bioRxiv - Biochemistry 2020Quote: ... and 500 uM 3-indole acetic acid (IAA) (Sigma-Aldrich I2886).
-
bioRxiv - Plant Biology 2021Quote: ... 10 or 100 nM IAA (Indole-3-acetic acid, Millipore Sigma), 100 nM or 1 µM ACC (1-aminocyclopropanecarboxylic acid ...
-
bioRxiv - Cell Biology 2021Quote: ... strips were blocked with 3% fatty acid-free BSA (Sigma-Aldrich) in PBS buffer containing 0.1% Tween 20 (PBS-T ...
-
bioRxiv - Molecular Biology 2021Quote: ... cells were treated with 500 µM 3-indoleacetic acid (auxin) (Sigma) in DMSO or mock-treated with DMSO alone ...
-
bioRxiv - Biochemistry 2020Quote: ... 500 μM IAA (indole-3-acetic acid dissolved in DMSO; Sigma) was added to media to induce degradation of the AID-tagged protein ...
-
bioRxiv - Cell Biology 2021Quote: ... and 0.05% Tween 20) containing 3% fatty acid-free BSA (Sigma) and gently agitated for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... Auxin indole-3-acetic acid sodium salt (IAA) (I5148, Sigma-Aldric) was used at 500 nM dissolved in water ...
-
bioRxiv - Cancer Biology 2024Quote: ... BxPC-3 cells were supplemented with non-essential amino acids (Sigma). Cultured cells were regularly tested for mycoplasma contamination and used within three months of defrosting.
-
bioRxiv - Neuroscience 2023Quote: ... 2,2’-azino-bis (3-ethylbenzthiazoline-6-sulfonic acid) (ABTS, Sigma-Aldrich) substrate was added to each well ...
-
bioRxiv - Cell Biology 2022Quote: Doxycycline (DOX) and auxin (indole-3-acetic acid, IAA) (Sigma-Aldrich) were dissolved in cell culture-grade water and used at 1 μg/mL and 500 μM ...
-
bioRxiv - Microbiology 2022Quote: 7 mmol ABTS (2,2’-azinobis-(3-ethylbenzothiazoline-6-sulfonic acid, Sigma) stock solution was mixed with 2.45 mmol potassium persulfate (K2S2O8 ...
-
bioRxiv - Cell Biology 2023Quote: ... and replaced with 500 µM Inole-3-acetic acid (IAA, Sigma) for 2h ...
-
bioRxiv - Cell Biology 2024Quote: ... were saturated with 3% fatty acid free BSA (Sigma-Aldrich A8806) in PBS-Tween-20 0.1% for 1 h at room temperature ...
-
bioRxiv - Biophysics 2024Quote: ... Linoleic Acid (EIC) (Sigma-Aldrich, L1376, CAS number: 60-33-3) were prepared immediately prior to use from DMSO stocks (100 mM) ...
-
bioRxiv - Microbiology 2024Quote: ... 8% polyacrylamide gel containing 0.5% 3- (Acrylamido) phenylboronic acid (Sigma-Aldrich) after resuspending in a 2X RNA Loading Dye (NEB) ...
-
bioRxiv - Microbiology 2024Quote: ... Standard solutions were prepared using poly (3-hydroxybutyric acid) (SIGMA Aldrich) and mcl-PHAs from Pseudomonas putida KT2440 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... MS 222 (3-aminobenzoic acid ethyl ester methane sulfonate, Sigma, Germany) was used to anesthetize all specimens ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μM IAA (indole-3-acetic acid dissolved in DMSO; Sigma) was added to media to induce degradation of the AID-tagged protein ...
-
bioRxiv - Cell Biology 2022Quote: ... rinsed in PBS and incubated with 3 μg/ml DAPI (4’,6-diamidino-2-phenylindole; D8417 from Sigma Aldrich) at RT for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... They were cut into 250μm parasagittal slices using a McIlwain tissue chopper and the slices placed on Millicell membrane (3-4 slices per membrane, 2 membranes per animal, 0.4 μm Millicell, Merck Millipore) in 50% BME (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2020Quote: ... BCH (Slc7a5 inhibitor 2-amino-bicyclo[2,2,1]heptane-2-carboxylic acid, Sigma-Aldrich) was stored as a 100 mM stock solution in 1N NaOH ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid, Sigma-Aldrich), 1.2 mg/ml Sodium Bicarbonate (Sigma-Aldrich/MilliporeSigma ...
-
bioRxiv - Cell Biology 2023Quote: A 100 mM stock of 2-bromopalmitic acid (2-BP, Sigma-Aldrich 248422) or methyl-palmitate (MP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... For autophagy inhibitors treatment, 3-methyladenine (3-MA, 5 mM) (Sigma-Aldrich), bafilomycin A1(Baf ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Chk1 (3’Chk1) (5’CUGGUGAAUAUAGUGCUGCUA3’ from Sigma-Aldrich), Polι (SMART pool ...
-
bioRxiv - Plant Biology 2022Quote: ... supplemented with 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich) and 0 mM ...
-
bioRxiv - Cell Biology 2020Quote: Mice were injected intraperitoneally with 3 mL of 3 % (v/v) thioglycolate (thioglycolic acid, Sigma-Aldrich, T3758) in PBS to elicit peritoneal macrophages using a 25G needle ...
-
bioRxiv - Bioengineering 2020Quote: ... gels were fabricated with a final concentration of 1×105 AFC/mL (P3-5) and incubated in EGM-2 +/- 1 mg/mL of the plasmin inhibitor 6-aminocaproic acid (Sigma, A2504) at 37°C and 5% CO2 ...
-
bioRxiv - Genomics 2021Quote: ... after which it was quenched with 5 mM of ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA, Sigma, E3889). The quenched reaction was subsequently centrifuged for 5 minutes at 300 rcf and the supernatant was carefully discarded ...
-
bioRxiv - Neuroscience 2023Quote: ... The pelleted PRP was resuspended in PBS containing prostaglandin E1 (2 μM, Absin) and ethylene diamine tetra acetic acid (EDTA) (5 mM, Sigma-Aldrich) to prevent platelet activation ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.5 µM (NMDA receptor antagonist that preferentially binds to GluN2C/GluN2D (40)) or DL-2-Amino-5-phosphonovaleric acid (APV, Sigma, A5282) 100 µM (broad spectrum NMDA receptor blocker).