Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for 3 2 5 Dioxoimidazolidin 4 yl propanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... 4–5-week-old mice were anesthetized by intraperitoneal injection of 2% 2,2,2-tribromoethanol (Sigma), dissolved in saline ...
-
bioRxiv - Neuroscience 2023Quote: ... (D-Ala(2)-mephe(4)-gly-ol(5))enkephalin (DAMGO, Sigma-Aldrich, Cat. No. E7384) at 50 µM or lipopolysaccharide (LPS ...
-
bioRxiv - Plant Biology 2022Quote: Indole-3-acetic acid (IAA, 10 μM; Sigma-Aldrich) and (+/-)-abscisic acid (ABA ...
-
bioRxiv - Molecular Biology 2020Quote: Indole-3-acetic acid sodium salt (Sigma I5148-2G) was dissolved in water to 500 mM ...
-
bioRxiv - Microbiology 2020Quote: ... 50 μM 3-(3,4-dihydroxyphenyl)propionic acid (102601, Sigma) or H2O as control ...
-
bioRxiv - Microbiology 2020Quote: ... acidified to pH ~3 using 100% formic acid (Sigma). No bacterial consortium control was used because the consortium stock culture was free of carbon and would not survive ...
-
bioRxiv - Systems Biology 2020Quote: ... For amino acid derivation 3 μL phthaldialdehyde (Sigma-Aldrich), i.e ...
-
bioRxiv - Cell Biology 2022Quote: ... At indicated times auxin (3-indolo acetic acid, Sigma) was added at a final concentration of 1-2.5 mM (table S4) ...
-
bioRxiv - Genetics 2022Quote: ... Auxin (3-indole acetic acid; Sigma-Aldrich Catalogue # I3705) was added to SC minimal media with 300 uM final concentration in DMSO ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM Phospho(enol)pyruvic acid (PEP; Sigma, P0564), 0.25 mM β-NADH (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... by using 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma). These cross-linked peptides were used to immunize rabbits ...
-
bioRxiv - Biochemistry 2021Quote: ... 10 mM formic acid pH 3 (Sigma-Aldrich F0507), 50% methanol (Honeywell LC230-4) ...
-
bioRxiv - Microbiology 2020Quote: ... and 1-Naphthohydroxamic Acid (6953-61-3, Sigma Aldrich) was done for 24 hours or 1 hour prior to IFN treatment ...
-
bioRxiv - Genetics 2020Quote: 70 mg of Auxin (3-Indoleacetic acid, Sigma #I3750) were dissolved in 10 ml DMSO to yield a 40 mM stock solution and stored at 4°C ...
-
bioRxiv - Systems Biology 2023Quote: ... 3-methyl-benzoate (3MB, m-toluic acid, Sigma T36609), was used at a concentration of 1mM ...
-
bioRxiv - Neuroscience 2023Quote: ... and Kainic acid (10 μM, Sigma #58002-62-3). The working dilution was directly added to the wells during MEA recordings ...
-
bioRxiv - Biochemistry 2024Quote: ... and 3 mM valproic acid sodium salt (Sigma-Aldrich) were added to the cells to enhance protein expression ...
-
bioRxiv - Cell Biology 2023Quote: ... 250 µM auxin (indole-3-acetic acid; Sigma Aldrich) dissolved in DMSO was top-plated on agar to induce degradation of the AID-tagged protein ...
-
bioRxiv - Cancer Biology 2023Quote: ... 150 µL of 3 M perchloric acid (Sigma, 244252) was added to each well and immediately covered with phenylethylamine (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... by using 3-maleimidobenzoic acid N-hydroxysuccinimide ester (Sigma). These cross-linked peptides were used to immunize rabbits ...
-
bioRxiv - Biophysics 2022Quote: Powder form of 3-sn-phosphatidic acid (Sigma Aldrich), Brain phosphatidylserine (Avanti Polar Lipids ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 μM auxin (indole-3-acetic acid; Sigma-Aldrich) dissolved in DMSO was added to liquid media or top-plated on agar to induce degradation of the AID-tagged protein ...
-
bioRxiv - Genetics 2022Quote: ... Auxin (3-indoleacetic acid) (Sigma-Aldrich, St. Louis, MO) was made as a 1M stock in DMSO then added to 500μM or 750μM final concentration in liquid media or plates ...
-
bioRxiv - Plant Biology 2024Quote: 3-Indoleacetic acid (IAA) was purchased from Sigma-Aldrich. The stock solution was prepared using dimethyl sulfoxide (DMSO ...
-
bioRxiv - Biophysics 2024Quote: ... and 3-(maleimido)propionic acid N-hydroxysuccinimide ester (Sigma). For co-grafted brushes ...
-
bioRxiv - Molecular Biology 2022Quote: ... Oligonucleotides 5’-GAAAAAAAAAATATACGCTAAGATTTTTGG-3’ and 5’-ATGACTAAACCCCCCCTCC-3’ synthesized and HPLC-purified by Sigma-Aldrich were used ...
-
bioRxiv - Physiology 2024Quote: ... CDH1 Forward 5′-TTACTGCCCCCAGAGGATGA-3′ and Reverse 5′-TGCAACGTCGTTACGAGTCA-3′;) were purchased from Sigma-Aldrich. mRNA expression was determined using the comparative 2-ΔΔCt method and normalized to the mRNA expression level of endogenous references (PPIA ...
-
bioRxiv - Biophysics 2024Quote: ... respectively: EcoEF7,3_For: 5’-GCACTATTTGCTATATATTGTGTGGTTGAATCTTTTTTCAACTACATCTAGTATCTC-3’ and EcoEF7,3_Rev: 5’-GAGATACTAGATGTAGTTGAAAAAAGATTCAACCACACAATATATAGCAAATAGTGC-3’ were ordered from Sigma-Aldrich, resuspended and annealed in buffer containing 10 mM Tris pH 7 ...
-
bioRxiv - Plant Biology 2020Quote: ... (±)-3-Hydroxydecanoic acid (3-OH-C10:0) and chitin were obtained from Sigma-Aldrich. All elicitors were dissolved in deionized MilliQ sterile water at the respective stock concentration of 1mM for flg22Pa ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 mg/ml biocytin (Sigma); pH∼7.2 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 mg biocytin (Sigma-Aldrich) was included in the intrapipette solution for morphological reconstruction ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Microbiology 2022Quote: ... and half of the water was replaced with freshwater (2/3 osmosis (RiOs 5, Merck Millipore) and 1/3 filtered ...
-
bioRxiv - Neuroscience 2024Quote: ... and 3 μg/mL 5-fluoro-2′-deoxyuridine + 7 μg/mL uridine (FRDU, F0503, Sigma-Aldrich). Cultured cells were then kept at 37°C and 5% CO2 in an incubator with culture media changes at 48 hours with supplemented media and NGF and FRDU until further experimentation.
-
bioRxiv - Developmental Biology 2023Quote: ... predicted mature peptide regions of ZmRALF1/2/3/5 genes were cloned into plasmid pET32b (Novagen) with gene specific primers as indicated (Supplemental Table S1) ...
-
bioRxiv - Biophysics 2020Quote: ... 2% MEM amino acids (50x, M5550, Sigma), 1% Penicillin Streptomycin (10,000 units/mL ...
-
bioRxiv - Neuroscience 2021Quote: ... Then 2 mM kynurenic acid (Sigma-Aldrich) was added into the compartment for the lumbar spinal cord ...
-
bioRxiv - Neuroscience 2020Quote: 2-phospho-Ascorbic Acid (Merck Sigma, #49752)
-
bioRxiv - Bioengineering 2021Quote: ... L-ascorbic acid-2-phosphate (Sigma-Aldrich), and 2mM L-Glutamine (Life Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... 100 µM ascorbic acid 2-phosphate (Sigma), and 4.7 µg/mL linoleic acid (Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 2% formic acid (FA; Sigma-Aldrich). MeOH was evaporated using N2 stream at room temperature and reconstituted in 150 µL reconstitution buffer (H2O/ACN/MeOH + 0,2% FA - 65:31,5:3,5) ...
-
bioRxiv - Biophysics 2021Quote: ... 2% Non-Essential Amino Acid (NEAA, Sigma) and 1% Glutamine ...
-
Development of follicular dendritic cells in lymph nodes depends on retinoic acid mediated signalingbioRxiv - Immunology 2020Quote: ... 86.5μM L-ascorbic acid 2-phosphate (Sigma) and 10ng/ml TGF-ß1 (Peprotech ...
-
bioRxiv - Bioengineering 2021Quote: ... 2-morpholinoethanesulfonic acid (MES, 19.52 g, Sigma) and NaCl (17.53 g ...
-
bioRxiv - Immunology 2021Quote: ... L-ascorbic acid 2-phosphate (Millipore-Sigma) was dissolved in water and sterilized with 0.22um syringe-filter and was added at a final concentration of 100 µg/mL (310.5 µM) ...
-
bioRxiv - Immunology 2021Quote: ... L-ascorbic acid 2-phosphate (Millipore-Sigma) was dissolved in water and sterilized with 0.22um syringe-filter and was added at a final concentration of 100 µg/mL (310.5 µM) ...
-
bioRxiv - Immunology 2023Quote: ... N’-bis(2-ethanesulfonic acid)] buffer (Sigma) for ten minutes at room temperature and blocked with cold normal donkey serum (Jackson ImmunoResearch ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 200μM L-Ascorbic acid 2-phosphate (Sigma) and 100 μg/ml penicillin-streptomycin with medium change every second day ...
-
bioRxiv - Neuroscience 2023Quote: ... 2-aminohexadecanoic acid (Sigma-Aldrich #08051-1G) was protected as described by Koppitz et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 µM Folic acid (#F8758, Sigma-Aldrich), 50 µM Thymidine (#T1895 ...