Labshake search
Citations for Millipore Sigma :
7301 - 7350 of 10000+ citations for P N Nonylphenol 13C6 99% 100 Ug Ml In Methanol since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... we gently denatured the histones by treating with 0.1 N HCl (Sigma H9892) diluted in water for 5 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... mouse monoclonal IgG2aĸ antibody with epitope matching the N-terminus (EMD Millipore #MABS1920), nuclear matrix protein p84 [EPR5662(2)] rabbit monoclonal antibody mapping with aa350-450 (abcam #ab131268) ...
-
bioRxiv - Systems Biology 2022Quote: ... A 1-hour pretreatment with 2mM N-acetyl cysteine (NAC; Sigma-Aldrich, A9165) was accomplished by addition to all staining ...
-
bioRxiv - Molecular Biology 2022Quote: ... Coverslips were mounted on slides using 3% (w/v) n-propyl gallate (Sigma) in an 80% glycerol solution and sealed with clear nail varnish ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich).
-
bioRxiv - Microbiology 2022Quote: ... Parasites were grown to >4% parasitaemia when 50 mM N-Acetylglucosamine (Sigma Aldrich) was added to the culture to eliminate asexual stages ...
-
bioRxiv - Plant Biology 2022Quote: ... N-(3-indolylacetyl)-DL-aspartic acid (IAA-Asp; Sigma-Aldrich, St. Louis, MO), (+/-)-jasmonic acid (JA ...
-
bioRxiv - Neuroscience 2024Quote: ... coverslipped using a mounting media solution of 0.5% N-propyl gallate (Sigma-Aldrich) and 90% glycerol in ddH2O ...
-
bioRxiv - Microbiology 2024Quote: ... 30 mM 3-(N-Morpholino)propanesulfonic acid (MOPS) (Sigma-Aldrich, Product No. 69947) was used as a buffering agent at pH at 7 during the experimental time course ...
-
bioRxiv - Microbiology 2023Quote: ... N-acetyl glucosamine (GlcNAc) provided by Sigma (Cas 7512-17-6, PN A4106).
-
bioRxiv - Bioengineering 2023Quote: ... in 50 mM of 2-(N-morpholino)ethanesulfonic acid (MES, Sigma-Aldrich Inc.) buffer (pH = 6) ...
-
Appropriate glycemic management protects the germline but not uterine environment in type 1 diabetesbioRxiv - Developmental Biology 2024Quote: Snap-frozen placental samples (n=25) were lyzed in TRI Reagent (Sigma-Aldrich) using the RETCH MM 400 Mixer Mill (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... β-hexosaminidase substrate (4-nitrophenyl N-acetyl-β-D-glucosaminide, 4 mM, Sigma) was then added to the supernatant and lysate for 1 h at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: WT and emx2el586/el586 heterozygous incrosses were incubated in 0.003% N-Phenylthiourea (Sigma). At 48 hpf ...
-
bioRxiv - Bioengineering 2023Quote: ... Cell pellet was collected and suspended in N-Ethylmaleimide (NEM) solution (Sigma Aldrich), and the resulting cell suspension was precipitated ...
-
bioRxiv - Biochemistry 2023Quote: ... Sensitivity to NO-inducing agents S-nitroso-N-acetyl penicillamine (SNAP) (N3398, Sigma) and Z)-1-[2-(2-Aminoethyl)-N-(2-ammonioethyl)amino]diazen-1-ium-1,2-diolate (DETA/NONOate ...
-
bioRxiv - Biochemistry 2024Quote: ... Fresh stocks of the monovalent reagents N-(propionyloxy)succinimide ester (PropNHS, Sigma-Aldrich), Biotin-X-NHS (Biotin-NHS ...
-
bioRxiv - Biochemistry 2024Quote: ... Fractions containing N-WASP were concentrated using Amicon Ultra Centrifugal Filter units (Millipore) and further purified by size exclusion chromatography using a Superdex 200 prepgrade column (Cytiva ...
-
bioRxiv - Neuroscience 2023Quote: ... mice received intraperitoneal injections of clozapine-N-oxide (CNO, Sigma, dissolved in saline) 10 minutes prior to the resident-intruder test.
-
bioRxiv - Biophysics 2023Quote: ... sodium chloride and trimethylamine N-oxide (TMAO) were all purchased from Sigma-Aldrich as previously reported (15,18-23) ...
-
bioRxiv - Neuroscience 2023Quote: ... Genotyping was performed with REDExtract-N-Amp (Sigma Aldrich, St. Louis, MO, USA) using primers JAX oIMR9462 ATGCTCCAGACTGCCTTGGGAAAAG ...
-
bioRxiv - Synthetic Biology 2023Quote: ... culture medium consisting of advanced DMEM/F12 supplemented with N-Acetylcysteine (Sigma-Aldrich), B plus supplement (bioGenous) ...
-
bioRxiv - Physiology 2023Quote: ... DNA extraction was done using REDExtract-N-Amp Tissue PCR kit (XNAT, Sigma). For the PCR reaction ...
-
bioRxiv - Biochemistry 2023Quote: ... Negative control samples were prepared using 10 mM N-ethymaleimide (NEM, Sigma-Aldrich) instead of mPEG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and N-acetyl-L-cysteine (NAC) (A9165) were from Sigma (Burlington, MA, USA). Rat tail collagen (354236 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-(N-Ethyl Carboxamide) adenosine (NECA) was purchased from Sigma-Aldrich (Cat. #119140), dissolved in DMSO to 10 mM stock ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Primary antibodies used for immunofluorescence were rabbit anti CCDC15 (1:1000 ...
-
bioRxiv - Biochemistry 2023Quote: ... Samples were further derivatized with 10 μL tert-butyldimethylsilyl-N-methyltrifluoroacetamide (Sigma, 394882) and incubating at 70°C for 60 minutes.
-
bioRxiv - Physiology 2023Quote: ... and plasma insulin (n=5) was analyzed by ELISA (EZRMI-13K, Sigma Aldrich), according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... The N-terminal hexahistidine tag was cleaved with ∼2 units of thrombin (Sigma) per 1 mg of protein ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were treated with 4 mM N-Acetyl-L-Cysteine (NAC) (Sigma-Aldrich) for 72 h ...
-
bioRxiv - Neuroscience 2024Quote: ... dechorionated at 24 hpf and incubated with 0.3% N-phenylthiourea (PTU; Sigma-Aldrich) to inhibit melanogenesis ...
-
bioRxiv - Biophysics 2024Quote: ... A stock solution was made of 1M N-ethylmaleimide (NEM; Sigma-Aldrich, USA) dissolved in distilled water ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were mounted using Mowiol mounting medium containing N-propyl gallate (Sigma-Aldrich). Anti-CCDC66 antibody was generated by immunizing rats (Koc University ...
-
bioRxiv - Biochemistry 2024Quote: ... with an N-terminal Myc-DKK tag and pETDuet-1 (Sigma-Aldrich, 71146) were used for expression in mammalian cells and bacteria ...
-
bioRxiv - Biochemistry 2024Quote: ... and 12.5 µl of 4-methylumbelliferyl N-acetyl-β-D-glucosaminide (Sigma-Aldrich) was incubated for 15 minutes at 37°C ...
-
bioRxiv - Cell Biology 2024Quote: ... the lysates were supplemented with 20 mM N-ethylmaleimide (NEM; E3876, Sigma-Aldrich) and mixed with loading buffer without β-mercaptoethanol ...
-
bioRxiv - Neuroscience 2024Quote: ... Genotyping was conducted with RED Extract-N-Amp (Sigma-Aldrich, St. Louis, MO) using primers R1965 5′ GCT CAA GGT TGT ATG CCT TGG TGC T 3′ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: Male mice (n=25) were gavaged with tideglusib or 26% peg-400 (Sigma), 15% Cremophor EL (Sigma) ...
-
bioRxiv - Synthetic Biology 2024Quote: 3-O-C6-HSL (N-(B-Ketocaproyl)-L-Homoserine Lactone from Sigma-Aldrich, cat # K3007 ...
-
bioRxiv - Cancer Biology 2021Quote: ... MV+ and MV- were lysed in a buffer composed of 2% Nonidet P-40 (Millipore Sigma), 0.5% sodium deoxycholate (Millipore Sigma) ...
-
bioRxiv - Cell Biology 2020Quote: ... Samples were subsequently separated by SDS-PAGE and transferred to Immobilon-P polyvinylidene difluoride membranes (Millipore). Immunoblot analysis was performed with the antibodies indicated and visualization was achieved with the Immobilon Western Chemiluminescent HRP substrate (Millipore).
-
bioRxiv - Microbiology 2021Quote: ... The cultures were then washed 3x in pre-warmed P-buffer containing 1% dimethylsulfoxide (DMSO, Sigma) to ensure removal of unbound dye molecules ...
-
Pluripotent stem cell SOX9 and INS reporters facilitate differentiation into insulin-producing cellsbioRxiv - Developmental Biology 2021Quote: ... 1% penicillin/streptomycin (P/S) (penicillin: Santa Cruz Biotechnology, Dallas, USA; streptomycin: Sigma-Aldrich, Munich, Germany), 2 mM glutamine ...
-
bioRxiv - Genomics 2020Quote: ... solution containing 1% each of Nonidet P-40 and Tween 20 (Millipore Sigma, St. Louis, MO). Additionally ...
-
bioRxiv - Physiology 2020Quote: ... mice were injected intraperitoneally with α-methyl-p-tyrosine (250 mg/kg α-MPT; Sigma-Aldrich), an active competitive inhibitor for TH ...
-
bioRxiv - Biophysics 2019Quote: ... Protein was transferred overnight at 10 V to an Immobilon-P membrane (Merck Millipore; Burlington, MA) in 25 mM Tris ...
-
bioRxiv - Cancer Biology 2019Quote: ... supplemented with 1 mM phenylmethyl sulfonyl fluoride (PMSF) and protease inhibitor cocktail (Sigma/Aldrich, P-8340). Membranes were collected by centrifugation at 212,000 × g for 60 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... cerebellum or hippocampus were resolved by SDS-PAGE and transferred onto PVDF Immobilon-P membranes (Millipore). After blocking with 5% nonfat dry milk in 1X TBS with 0.1% Tween-20 (TBST ...
-
bioRxiv - Neuroscience 2021Quote: ... The cell lysates were resolved by SDS-PAGE and transferred onto PVDF Immobilon-P membranes (Millipore). After blocking with 5% nonfat dry milk in TBS containing 0.1% Tween 20 for 1hr at room temperature ...