Labshake search
Citations for Millipore Sigma :
7201 - 7250 of 10000+ citations for Cow Fructose 1 6 Bisphosphatase 2 FBP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2019Quote: ... Slides were dried for 6 min and subsequently incubated at room temperature with Wright stain (Sigma-Aldrich) for 8 mins ...
-
bioRxiv - Bioengineering 2020Quote: ... as-synthesized mesoporous silica nanoparticles (AMS-6) were loaded with 20% Dox (Doxorubicin hydrochloride, #D1515, Sigma-Aldrich). Dox diluted in 100% ethanol was added to AMS-6 nanoparticles in a round bottom flask mounted on a rotary evaporator ...
-
bioRxiv - Bioengineering 2020Quote: ... the glass fiber capture membrane was submerged for 6-8 hours in trifluoroacetic acid (TFA, Sigma-Aldrich), and dried at room temperature overnight before assembly ...
-
bioRxiv - Bioengineering 2020Quote: ... FMN was added in excess (above its solubility limit) (F6750, Sigma-Aldrich: 70% pure, free RbF ≤ 6%) and samples were incubated on ice for at least 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... A549 (ATCC) or HeLa (ATCC) cells were transduced in the presence of 6 ug/mL polybrene (Millipore) for 24 h ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Trichloroethylene (CAS Number 79-01-6) and other chemicals were purchased from Sigma-Aldrich (St. Louis, MO) unless otherwise noted ...
-
bioRxiv - Neuroscience 2019Quote: Samples were incubated in a blocking solution of 10% DMSO/6% donkey serum (EMD Millipore, Temecula, CA)/0.2% Triton X-100/PBS at 37 °C for 2-3 days ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... They were then washed and permeabilized 6 x 5mins in PBSTx (PBS plus 0.5% Triton-X (Sigma)) and blocked for 2 hrs room temperature in PBSTx plus 5% goat serum (Sigma) ...
-
bioRxiv - Developmental Biology 2021Quote: ... vibratome sections (500 µm) from wild-type (C57BL/6) lungs were stained with rabbit anti-SftpC (Millipore) and Armenian hamster anti-Muc1 (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... UFM1 (GCTGTGAAAGGTGTACTTTC) and UFC1 (GTGACAACGATTGGTTCCGAC) followed by selection with 75 µg/ml 6-thioguanine (Sigma-Aldrich, A4882) 4 days after electroporation ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 6-day-old perithecia with TRI Reagent (Sigma-Aldrich, cat. no. T9424) and re-suspended in 5M urea ...
-
bioRxiv - Immunology 2020Quote: ... T cells were also stimulated for 6 hours with 50ng/ml PMA and 1μg/ml Ionomycin (Sigma). T cells were then harvested ...
-
bioRxiv - Molecular Biology 2021Quote: Melanoma cells treated with ARN22089 for 6 or 24 h and lysed in RIPA buffer (EMD Millipore or an optimized cocktail (250 mM NaCL ...
-
bioRxiv - Microbiology 2021Quote: ... approximately 3 to 6 L of diffuse flow fluid were pumped through 0.22 μm Sterivex filters (Millipore). Shipboard ...
-
bioRxiv - Developmental Biology 2021Quote: Adult fish (between 3-6 mpf) were anesthetized by immersion into 0.04% tricaine (Sigma, St Louis, MO) and the AF were carefully detached using surgical blade and forceps ...
-
bioRxiv - Developmental Biology 2021Quote: ... or the embryos were treated for 6 days with 0.003% N-phenylthiourea (PTU) (Sigma, St Louis, MO) to inhibit pigment formation.
-
bioRxiv - Genetics 2020Quote: ... cells were permeablised first with 1ml/well (6-well plate) mTESR1 medium with 8μg/ml polybrene (Millipore) for 15 min (37°C) ...
-
bioRxiv - Bioengineering 2020Quote: ... 20 g (±5 g) female C57BL/6 mice were injected intraperitoneally (I.P) with LPS (L-5886, Sigma). EVs were I.V injected via the tail vein subsequent to LPS induction and the animals were observed and weighed daily after induction ...
-
bioRxiv - Microbiology 2020Quote: ... 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.5 μg TRC2-pLKO-puro vector encoding shRNA (TRCN0000377256-NM_005871.3-637s21c1, designated here as shSMNDC1-6, or TRCN0000369078-NM_005871.3-724s21c1, designated here as shSMNDC1-7, Sigma) targeting different sequences of SMNDC1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Successfully transduced cells were then selected using blasticidin (6 µg/ml, Cat. no. 15205, Sigma-Al- drich). For the experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... fibroblasts were seeded at 2.25×104 into each well of 6 well dishes (Millipore Sigma Cat. CLS3516) in 2ml complete M106 on Day 0 and grown overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... Adult mice (7 week old) mice were injected with 6 mg of Tamoxifen in Corn Oil (Sigma) intraperitoneally for 3 days ...
-
bioRxiv - Genetics 2022Quote: ... UMOD-GFP cells were treated for 6 h with 2.5 μM proteasome inhibitor MG132 (M8699, Sigma-Aldrich). Protein samples were collected at 2 ...
-
Ultra-high-throughput microbial single-cell whole genome sequencing for genome-resolved metagenomicsbioRxiv - Microbiology 2022Quote: ... the barcode beads were washed three times in 6 x SSC buffer (Sigma, catalog no. S0902-1L) and loaded into Countess (Thermo-Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 6 weeks aged mice were fed with drinking water containing 50 μg/mL 4NQO (Sigma-Aldrich, N8141) for 16 weeks and then given normal drinking water for additional 10 weeks ...
-
bioRxiv - Neuroscience 2023Quote: ... confluent wells in a 6-well plate were incubated with 20mM NH4Cl (Sigma-Aldrich, St Louis MO) and 300μM leupeptin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-8 weeks-old mice were intraperitoneally injected with 0.1mL of 10mg/mL 4-hydroxytamoxifen (Sigma Aldrich) dissolved in a solution of DMSO ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-week- old male mice were injected with 25 mg/kg LPS (Sigma Aldrich, St. Louis, MO) or PBS above calvariae ...
-
bioRxiv - Neuroscience 2024Quote: ... or 5 mM 4-methylumbelliferyl N-acetyl-β- D-glucosaminide-6-sulfate (HEXA; Sigma Aldrich, MS, USA) in 0.1 M citric acid/NaOH buffer (pH 4.4 ...
-
bioRxiv - Systems Biology 2024Quote: ... 6 - 10 worms were then randomly picked in a drop of 20 mM tetramisole (Cat. T1512, Sigma) and then aligned on an empty NGM plate ...
-
bioRxiv - Systems Biology 2024Quote: ... and reporter cell lines (170,000 cells) were transduced in the presence of 6 µg/ml polybrene (Sigma). Cells were harvested 24 hours later and plated in medium containing 1 µg/ml Puromycin (InvivoGen ...
-
bioRxiv - Developmental Biology 2024Quote: ... fibroblasts were collected and transferred equally to a 6-well plate coated with Matrigel in DMEM (Sigma) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2024Quote: ... and subsequently transduced two times with viral supernatant in the presence of 6 ug/ml polybrene (Sigma) and 50 U/ml IL-2 ...
-
bioRxiv - Neuroscience 2024Quote: ... EAE was induced in C57BL/6 mice by immunization with oligodendrocyte glycoprotein 35–55 (200 μg; Sigma) in incomplete Freund’s adjuvant supplemented with Mycobacterium tuberculosis H37Ra ...
-
bioRxiv - Immunology 2024Quote: ... 6-FP was washed off and the cells treated with 50 μg/ml Brefeldin A (BFA, Sigma) or the equivalent volume of DMSO (Sigma ...
-
bioRxiv - Bioengineering 2024Quote: ... mice at 6 to 8 weeks of age were conditioned with busulfan (Sigma, St. Louis, MO, USA) injected intraperitoneally (25 mg/kg body weight/day ...
-
bioRxiv - Molecular Biology 2023Quote: ... Then 0.2 mL of washed IgG Sepharose 6 Fast Flow beads (Millipore Sigma, Cat#: GE17-0969-01) were added to each sample and incubated on a rotisserie mixer for 0.5 h at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... All medium for microfluidic experiments contained 20mg/L Pluronic F127 surfactant (CAS 9003-11-6, Sigma-Aldrich).
-
bioRxiv - Systems Biology 2022Quote: ... Shapes were then re-suspended in 6 μL of 80 mM triethylammonium bicarbonate buffer (pH 8.5, Sigma) with 0.013% dodecyl-β-D-maltoside (DDM ...
-
bioRxiv - Cell Biology 2023Quote: ... at density .5×106 cells / 6-well plate coated with gelatin (Millipore, cat. no. ES-006-B). Cells were cultured in basic culture media (described above ...
-
bioRxiv - Microbiology 2023Quote: ... To each sample was then added 6 µL 50 mM CuSO4 (Sigma-Aldrich, dissolved in MQ-H2O), 14 µL 100 mM Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA ...
-
bioRxiv - Systems Biology 2023Quote: ... The agarose pads were made from OmniPur® Low-Melting Agarose (Merk Millipore, CAS 9012-36-6). After drying ...
-
TIPRL1 and its ATM-dependent phosphorylation promote radiotherapy resistance in head and neck cancerbioRxiv - Cancer Biology 2023Quote: ... cells were irradiated with 6 Gy and DNA was labeled with 75 µM Bromodeoxyuridine (BrdU) (Sigma, #B5002) 1h before the indicated time points ...
-
bioRxiv - Bioengineering 2023Quote: ... PBMCs were incubated in prewarmed 6-well plates containing RPMI media supplemented with 10% FBS (Sigma-Aldrich), 1% Pen/Strep (Gibco) ...
-
bioRxiv - Bioengineering 2022Quote: ... GAG concentrations were calculated from a standard curve of Chondroitin-6-Sulfate from shark cartilage (Sigma-Aldrich). Standards were ranged 0 ...
-
bioRxiv - Biophysics 2022Quote: ... 400 µl Skeletal Muscle Cell Growth medium supplemented with 1.5 mg/ml 6-aminocaproic acid (ACA, Sigma) was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were infected and after 48 h selected and expanded with 6 μg/mL puromycin (Sigma-Aldrich).
-
bioRxiv - Cell Biology 2023Quote: ... the medium was collected and 6 μL of sterile hexadimethrine bromide (5 μg/μL; Sigma-Aldrich #H9268) was added ...
-
bioRxiv - Cell Biology 2023Quote: ... Coverslips were left to dry completely before being mounted with 6 µl of Mowiol 4-88 (Sigma) according to manufacturer’s instructions.