Labshake search
Citations for Millipore Sigma :
7001 - 7050 of 10000+ citations for 6 METHOXY PYRIDINE 3 SULFONYL CHLORIDE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... After rinsing sections were incubated 10 min at room temperature (RT) with 0.001 % DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, Sigma, D9542) in PBS for nuclear staining ...
-
bioRxiv - Biochemistry 2021Quote: ... from Arthrobacter ureafaciens (cat # 10269611001) and α2-6-sialyltransferase from Photobacterium damsela (Pd2-6ST, cat # S2076) were purchased from Sigma. CMP-Neu5Ac (cat # 233264 ...
-
bioRxiv - Neuroscience 2022Quote: ... HeLa cells were rinsed with PBS and cultured in the normal culture medium supplemented with 100 μM 6-aminonicotinamide (Sigma) (6AN ...
-
bioRxiv - Neuroscience 2022Quote: ... and four old (24-month old) male C57BL/6 mice were deeply anesthetized and perfused with cold PBS (Sigma, D8537). Each brain was carefully removed and individually micro-dissected under a dissection microscope ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 μL of beads were washed with PBS and incubated with 6 μg of anti-FLAG antibody (Sigma-Aldrich, F1804) in PBS + 0.5% BSA at 4°C for 3 h with gentle rocking ...
-
bioRxiv - Microbiology 2022Quote: ... cells were replated in 6-well plates with RPMI medium containing 1mg/mL G-418 (Sigma-Aldrich, St. Louis, MO). As we described previously (52) ...
-
bioRxiv - Physiology 2022Quote: ... virgin female flies were collected within 6 h of eclosion and reared on standard medium supplemented with 1.5 mM methoprene (Sigma-Aldrich, St Louis ...
-
bioRxiv - Immunology 2022Quote: ... The sections were washed in PBS and incubated 10 min with 4’,6-diamidino-2-phenylindole (DAPI, 1/10,000, Sigma-Aldrich) to visualize the cell nuclei ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were moved to a humidified chamber with primary antibody (anti-acetyl-alpha tubulin, clone 6-11B-1, Sigma, MABT868) diluted in PBX (1:250 ...
-
bioRxiv - Microbiology 2022Quote: A CRISPR array containing 6 identical spacers targeting the tetR gene flanked by 7 repeats was cloned into pCDF-Duet (Novagen, Merck Millipore) by ligation after NcoI and SalI digestion ...
-
bioRxiv - Neuroscience 2019Quote: ... 5, 6 and 7 (days 52 to 55 in the overall timeline, Figure 2) at 100 mg/kg ip (Sigma), at approximately 17:00 hr ...
-
bioRxiv - Bioengineering 2019Quote: Substrates were placed into 6-well plates and both chambers were washed three times with 50 mM HEPES pH 8.5 (Sigma H3375). The polyacrylamide was activated for ECM protein coating by covering the substrates with 500 μL of 0.5 mg/mL sulfo-SANPAH (Proteochem c1111 ...
-
bioRxiv - Biochemistry 2019Quote: ... or doxycycline-treated (Dox) (1 µg/ml for 6 days) AW13516-shNPM1-luc+ cells using the GenElute Mammalian Total RNA Miniprep Kit (Sigma) followed by On-Column DNase I Digestion as per manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... ten first or second leaves from independent plants were harvested at the indicated time points and transferred to a 15 ml tube containing 6 ml water purified using a Milli-Q integral 5 water purification system (Millipore). After a 6 h-incubation at room temperature on a horizontal shaker ...
-
bioRxiv - Neuroscience 2019Quote: ... Picked spheres were plated (20 spheres per well of a 6-well plate) onto Nunclon-Δ plates coated with 0.1 mg mL−1 poly-L-ornithine (Sigma) followed by 10 µg mL−1 laminin (PO/Lam coating ...
-
bioRxiv - Cancer Biology 2019Quote: ... 25 μl Ad5CMVFlpO (6 × 1010 PFU/ml) was incubated with 600 μl minimum essential media (Sigma-Aldrich, St Louis, MO) and 3 μl 2 M CaCl2 (Sigma-Aldrich ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... 6 µl homogenate was mixed with 94 µl Glucose Oxidase (GO) reagent from the Glucose (GO) Assay Kit (Sigma, GAGO20) containing 1 µl (0.3 U ...
-
bioRxiv - Cell Biology 2019Quote: ... The sample was then cut in half with a clean razor and each piece was placed in a 6-well plate with 10 ml of ASW and lipopolysaccharide (LPS) from Escherichia coli 0111:B4 (Sigma) at a final concentration of μg/ml (or an equal volume of sterile diH2O ...
-
bioRxiv - Molecular Biology 2019Quote: ... U2OS cells were seeded in a 6-well plate and infected with lentivirus supernatant in the presence of 5 μg/mL polybrene (Sigma). Medium was replaced by fresh media with 10 μg/mL Blasticidin S at 24 hours post-infection ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were washed three times with 1x PBS and incubated for 5 minutes in 300 nM 4′,6-diamidino-2-phenylindole (Sigma) before a final 1x PBS wash ...
-
bioRxiv - Cell Biology 2019Quote: Undifferentiated SGBS cells were plated at 50 % confluence in 6-well plates and infected with commercial lentiviral particles targeting either human ABCG1 (TRCN0000420907; Sigma) (TAGGAAGATGTAGGCAGATTG ...
-
bioRxiv - Molecular Biology 2019Quote: ... All RNAs were then selectively modified with 10mM 1-methyl-6-nitroisatoic anhydride (1M6) (Sigma-Aldrich cat no. S888079-250MG) for 5 minutes at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: ... Sections were further incubated for 10 min at room temperature with DAPI (4’,6-diamidino-2-phenylindole, 1:5000, Sigma). Incubation with the secondary antibodies lasted for 3h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and MCA-Lys-Pro-Leu-Gly-Leu-Dpa(DNP)-Ala-Arg-NH2 (MMP substrate FS-6) was from Sigma-Aldrich. The stock solutions of the enzyme inhibitors and fluorogenic substrates were prepared according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... and resuspended in 50 to 80 µl FC buffer containing 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich). Primary tumor samples were stained with CD45-APC-Cy7 (Biolegend ...
-
bioRxiv - Developmental Biology 2020Quote: ... Next the slides were mounted with a coverslip using Mowiol (6 g glycerol, 2.4 gr polyvinylalcohol 4-88 (Sigma, 81381), 6 ml MQ and 12 ml 0.2 M Tris HCL pH 8.5).
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... Slides were air dried for 6 hours to overnight with a post-fixation step of 15 minutes in 10% neutral buffered formalin (HT501128, Sigma) and washed in 1X PBS ...
-
bioRxiv - Neuroscience 2020Quote: ... To identify the total number of cells the nuclei were stained with DAPI (4’, 6-Diamino-2-phenylindole dihydrochloride) (1:10000, Millipore-Sigma). Images were acquired using Olympus BX61 microscope and analyzed using Fiji software (ImageJ).
-
bioRxiv - Microbiology 2021Quote: ... Labeled lentivirus particles were then purified to eliminate excess free dyes and lipids by ultracentrifugation for one hour at 40,000 rpm over a 6%-18% Optiprep (Sigma Aldrich) gradient ...
-
bioRxiv - Synthetic Biology 2020Quote: ... glass coverslips placed in 6-well plates were coated in a 0.1 mg/mL solution of poly-L-lysine hydrobromide (Sigma #P6282) for 5 min and left to dry overnight before plating 6×105 cells per well in 2 mL DMEM ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cells were transiently transfected with plasmids in 6-well plates and 24 hours post-starvation were incubated with 100μg/ml of cycloheximide (Sigma #4859) for indicated time points ...
-
bioRxiv - Immunology 2019Quote: PBMCs (freshly isolated and previously frozen) and fresh whole blood were each stimulated for either 2 or 6 h with (1) PMA/ionomycin (Sigma) (PBMC ...
-
bioRxiv - Pathology 2021Quote: ... rats in the high-dose 7-d L-DOPA priming group (n=6) were treated daily with L-DOPA (12 mg/kg) + benserazide (15 mg/kg, s.c., Sigma-Aldrich) for 7 d (i.e. ...
-
bioRxiv - Cell Biology 2019Quote: ... and plasma (n=6) of the experimental groups were filtered with a 30 kDa cut-off Microcon filter (Merck Millipore, Tullagreen Carrigtwohill Co.Cork ...
-
bioRxiv - Cancer Biology 2019Quote: ... Tissues were washed 5 times in PBT and incubated for 2h at RT with secondary antibodies and 4’,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, Sigma) (1µg/mL) ...
-
bioRxiv - Developmental Biology 2020Quote: ... An incubation was done 45 min at room temperature with a mix of 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI, 1µg/mL, 10236276001, Sigma-Aldrich) and the secondary antibody Donkey anti-Mouse Alexa Fluor 555 in PBS 1X ...
-
bioRxiv - Biophysics 2019Quote: ... as a Tobacco Etch Virus (TEV)-cleavable N-terminal His-tagged (6×-His) fusion protein using a pET46 Ek/LIC vector (Novagen) and purified using Ni-NTA affinity chromatography and gel filtration chromatography as previously described (Hughes et al ...
-
bioRxiv - Physiology 2020Quote: ... and probed overnight (4 °C) with one of the following primary antibodies: Anti-TSG-6 mouse monoclonal (1 μg/ml; Millipore); rat monoclonal TNFα (1 μg/ml ...
-
bioRxiv - Molecular Biology 2019Quote: ... was fused with an N-terminal His(6)-tag followed by maltose binding protein (MBP) tag and TEV cleavage site in pET21 vector (Novagen).
-
bioRxiv - Cancer Biology 2019Quote: ... RIPK3 inhibitor GSK 872 (N-(6-(Isopropylsulfonyl)quinolin-4-yl)benzo[d]thiazol-5-amine) was purchased from Millipore Sigma and frozen stocks were maintained in DMSO ...
-
bioRxiv - Cell Biology 2019Quote: ... then stained in 1x PBS + .5M NaCl with 50 ng/mL 4’,6-diamidino-2-phenylindole (DAPI) (Sigma-Aldrich #D9542).
-
bioRxiv - Bioengineering 2021Quote: ... at −20°C for 6 minutes followed by a 1-hour incubation in blocking buffer containing 10 wt% BSA (Sigma) in PBS as previously described7 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The pregnant mice were serially scanned at E6.5 either after intra-peritoneal administration of 1µg/g BW of hyaluronan synthesis inhibitor 6-diazo-5-oxo-1-norleucine (DON, Sigma-Aldrich) at E3.5-E5.5 ...
-
bioRxiv - Cell Biology 2020Quote: ... fixed accessory glands were permeabilised for 6 x 10 min in PBST (1 X PBS, 0.3% Triton X-100 [Sigma-Aldrich]), blocked for 30 min in PBSTG (PBST ...
-
bioRxiv - Cell Biology 2019Quote: ... The resin was resuspended in 6 ml ice-cold G-buffer containing 5 µg/ml TLCK-treated chymotrypsin (Sigma, #C3142) and incubated overnight at 4°C ...
-
bioRxiv - Physiology 2020Quote: ... rubens (< 6 cm diameter) were fixed by immersion in seawater Bouin’s fluid [75% saturated picric acid (Sigma-Aldrich, Gillingham, UK) in seawater ...
-
bioRxiv - Microbiology 2021Quote: ... in 6 well plates were transfected with HSIV-vif plasmids using Fugene 6 or X-tremeGENE 9 DNA transfection reagent (Roche/Sigma). At 48 hour post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... and mouse monoclonal anti-Na+/K+ ATPase (1:500; SantaCruz) and anti-acetylated tubulin (1:2,000; clone 6-11B-1, Sigma Aldrich). Goat anti-mouse or rabbit IgG conjugated with HRP were used for secondary antibodies (1:10,000 ...
-
bioRxiv - Physiology 2021Quote: ... 6 × 105 cells were seeded on 6-well multiwell plates and counted every two days from day 4 to day 14 using Trypan blue (Sigma) and a Neubauer chamber.