Labshake search
Citations for Millipore Sigma :
6951 - 7000 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... 3 mM phosphoenolpyruvate (PEP) (Molecula, 16921512) and 16 units/ml lactic dehydrogenase/pyruvate kinase enzymes (Sigma, P0294). 30 mL reactions were prepared in 384 well plates (Greiner ...
-
bioRxiv - Immunology 2020Quote: Cell pellets from 3 hour monocyte co-cultures were harvested and lysed with RIPA buffer (Sigma-Aldrich) supplemented with protease and phosphatase inhibitors (Cell Signalling ...
-
bioRxiv - Synthetic Biology 2020Quote: Synthetic lipid 1,2-di-O-phytanyl-sn-glycero-3-phosphocholine (Avanti) was diluted in tridecane (Sigma-Aldrich) to a final concentration of 15 mg/mL ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... the fish were immersed in fresh buffered Tricaine (3-amino benzoic acid ethyl ester; Sigma A-5040) diluted in system water (0.016%w/v ...
-
bioRxiv - Microbiology 2021Quote: ... The cells were blocked with 3% BSA and incubated with mouse anti-EBV-EAD (1:250, Millipore) and rabbit anti-YTHDF2 (1:250 ...
-
bioRxiv - Microbiology 2021Quote: ... Plates were incubated for 3 hours before addition of 30 μL of the bacterial growth reporter MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] (2.5 mg/mL) (Sigma) and Tween 80 (10% ...
-
bioRxiv - Systems Biology 2019Quote: ... Six oligos for Fgf21 and 3 oligos for Lss (Sigma-Aldrich, St. Louis, MO; Supplementary Table 1) were tested ...
-
bioRxiv - Plant Biology 2019Quote: ... or H2O as a control and an equal volume of H2O containing 10 mM 3-MA (Sigma) for inhibition of autophagy ...
-
bioRxiv - Genetics 2020Quote: ... membranes were washed 3 times for 10 minutes at room temperature with 0.1% Tween 20 (Sigma-Aldrich) in 1X TBS ...
-
bioRxiv - Biochemistry 2020Quote: ... phosphatidyl-choline (2-oleoyl-1-palmityl-sn-glycero-3-phosphocholine) were from Sigma-Aldrich (St. Louis, MO); Ezetimibe and lysophosphatidylcholine (1-palmitoyl-sn-glycero-3-phosphocholine ...
-
bioRxiv - Cell Biology 2020Quote: ... Blots were also probed with rabbit anti-Na+/K+ ATPase α-3 antibody (Millipore Sigma, 1:1000) and rabbit anti-tubulin (Cell signaling ...
-
bioRxiv - Genomics 2021Quote: ... after which the supernatant was replaced by 50 μL of dispase (3 mg/mL, Sigma-Aldrich_D4818-2mg), 75 μl collagenase I (100 mg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... pH 4.46) was prepared by infusing 3 g of leaves with 0.1 g ascorbic acid (Sigma Aldrich) for 4 min in 300 ml freshly boiled water under gentle movement ...
-
bioRxiv - Biochemistry 2021Quote: ... Sodium azide (NaN3) and 3-(trimethylsilyl) propionate-2,2,3,3-d4 sodium salt (TSP) were obtained from Sigma-Aldrich, United Kingdom ...
-
bioRxiv - Neuroscience 2021Quote: ... 10-week-old animals were given 3 daily intraperitoneal injections of 50 mg/kg bromodeoxyruidine (BrdU; Sigma) and perfused 28 days later ...
-
bioRxiv - Cell Biology 2019Quote: ... After fixation cells were washed 3 times with PBS and quenched using 1% NaBH4 (Sigma, 452882-25G) solution (in PBS ...
-
bioRxiv - Developmental Biology 2020Quote: ... Phosphopeptide standards (0.1 pmol of MS PhosphoMix 1, 2, 3 Light; Sigma-Aldrich, St. Louis, Missouri, USA) was added to suspended sample in binding/equilibration buffer ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 μL of 1× ligand (Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amine (Sigma-Aldrich) 20% DMSO in t-butanol) ...
-
bioRxiv - Biochemistry 2021Quote: ... coli polar lipids (Avanti, US) and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) (Sigma Aldrich) in a 3:1 molar ratio ...
-
bioRxiv - Biochemistry 2021Quote: ... Adenosine 3′-phosphate 5′-phosphosulfate lithium salt hydrate (PAPS) and the antibiotics were purchased from Sigma-Aldrich Co ...
-
bioRxiv - Biochemistry 2021Quote: ... phosphatase inhibitor cocktail 2 and phosphatase inhibitor cocktail 3 were purchased from Sigma-Aldrich (St. Louis, MO). All other chemicals including V8 protease were purchased from FUJIFILM Wako ...
-
bioRxiv - Immunology 2021Quote: Lentivirus based knockdown of human ATG16L1 (5’-ACTGTAGCTTTGCCGTGAATG-3’) was performed using MISSION shRNA constructs (Sigma-Aldrich) and psPAX2 packaging system ...
-
bioRxiv - Neuroscience 2021Quote: ... A CRISPR-Cas9 crRNA (5’- GAGGCCAAGATGAGTACTGAGG-3’) targeting exon 2 of Blvra was synthesized by Sigma Aldrich. A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’ ...
-
bioRxiv - Developmental Biology 2021Quote: ... and transferred onto a round 25 mm coverslip previously coated with 3-(trimethoxysilyl) propyl methacrylate (Sigma-Aldrich). Medium was then replaced with 10% PEG-DA hydrogel solution (esibio ...
-
bioRxiv - Physiology 2021Quote: ... 1M MgSO4)) in a 3 μL drop of M9 containing 25 mM sodium azide (NaN3, Sigma-Aldrich). Images were acquired using a Leica TCS SP8 STED 3X confocal microscope at 63x ...
-
bioRxiv - Cancer Biology 2021Quote: Polyacrylamide (PA) gels of varying stiffness (0.5, 2, and 5 kPa) were fabricated on 3-APTMS (Sigma) functionalized glass coverslips by combining 40% acrylamide and 2% bis-acrylamide in specific ratios as described previously [81] ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was assessed by 3-(4,5-1,2methylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay (Merck Millipore). K562 cells (5,000/well ...
-
bioRxiv - Cell Biology 2020Quote: ... Subsequently 3 mL of 100 μM istaroxime (MedCham Exptress, Lot#11394) or ouabain (Sigma-Aldrich, Lot#BCBZ9329) in E3-MS-222 solution was added ...
-
bioRxiv - Bioengineering 2020Quote: ... Zebrafish were sacrificed with a lethal dose of MS-222 (Ethyl 3-aminobenzoate methanesulfonate) (Sigma-Aldrich, UK), followed by washing with 0.5% sodium hypo chloride or bleach (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: Mid-L2 Larvae were transferred to fresh medium containing 3 mg/ml chloroquine (Sigma-Aldrich Cat. # C6628) and 0.3% Erioglaucine disodium (Sigma-Aldrich Cat ...
-
bioRxiv - Microbiology 2021Quote: ... Bacterial suspensions were then diluted 1:3 in PBS and incubated with 1μM all-trans retinol (Sigma) for 3 hr in a 24-well plate at 37’C with gentle shaking at 120 rpm under light-restricted conditions ...
-
bioRxiv - Immunology 2020Quote: Adult zebrafish were euthanized with 200 – 300 mg/L of ethyl 3-aminobenzoate methanesulfonate (tricaine) (Sigma, E10521) prior to dissection ...
-
bioRxiv - Microbiology 2020Quote: ... PHAs were stained in the biological samples with Nile red (CAS n. 7385-67-3, Sigma Aldricht), as in (34) ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.1 mM IBMX (3,7-dihydro-1-methyl-3-(2-methylpropyl)-1H-purine-2,6-dione) (Sigma Aldrich)) ...
-
bioRxiv - Immunology 2021Quote: ... Medium was replaced every 3 days thereafter with fresh R+ containing FCS (10% v/v; Sigma-Aldrich). Antigen-specific CD8+ T cells were characterized via flow cytometry on day 10.
-
bioRxiv - Molecular Biology 2020Quote: ... paraffin-embedded tissue sections (3-mm) using commercial Masson’s trichrome staining kits (Sigma–Aldrich, St. Louis, MO) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... approximately 3 to 6 L of diffuse flow fluid were pumped through 0.22 μm Sterivex filters (Millipore). Shipboard ...
-
bioRxiv - Microbiology 2021Quote: ... and the reaction was initiated by the addition of 3.7 mM sn-glycerol-3-phosphate (Sigma Aldrich). The reduction of MTT at 570 nm was continuously monitored on a BMG LABTECH plate reader for 118 min at room temperature.
-
bioRxiv - Developmental Biology 2021Quote: Adult fish (between 3-6 mpf) were anesthetized by immersion into 0.04% tricaine (Sigma, St Louis, MO) and the AF were carefully detached using surgical blade and forceps ...
-
bioRxiv - Cell Biology 2019Quote: ... Isolated muscles from female C57BL/6J mice were pre-incubated with 40 µM IPA-3 (Sigma-Aldrich) or as a control DMSO (0.25% ...
-
bioRxiv - Microbiology 2020Quote: ... 6 ml of amniotic fluid was dissolved in 3 ml of glycerol (≥99 %, G2025, Sigma-Aldrich (Merck), Overijse ...
-
bioRxiv - Microbiology 2020Quote: ... 0,25 mL of concentrated and normalized supernatant was added to 0,75 mL reaction buffer (0,05M Tris-HCl, 0,5 mM CaCl2, pH 7,5, 3 mg.mL-1 Azocasein (Sigma A2765)) preheated at 37°C and vortexed ...
-
bioRxiv - Neuroscience 2022Quote: ... The 2 odors used were 3-Oct (Sigma-Aldrich Cat# 218405-250G; CAS Number: 589-98-0) and MCH (Sigma-Aldrich Cat# 66360-250G ...
-
bioRxiv - Immunology 2022Quote: ... The coverslips were treated with 1% v/v solution of (3-acryloxypropyl)trimethoxysilane (APS, Merck - Sigma Aldrich) in ethanol for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Desalted siRNAs modified by double-deoxythymidine overhangs at 3’-ends of both strands were synthesized by Sigma. AllStars Negative Control siRNA (QIAGEN ...
-
bioRxiv - Plant Biology 2022Quote: ... The permeability of the seedlings was increased by incubating them in 3% IGEPAL CA-630 (Sigma, 18896) and 10% DMSO in PBS for 18 min ...
-
bioRxiv - Microbiology 2022Quote: ... cooled down on ice for 3 min and incubated each with 100 U of benzonase (E1014, Sigma) for 30 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... to remove residual beads before concentrating using 3 kDa MWCO Amicon Ultra-0.5 centrifugal filters (Millipore, UFC5003). Concentrated eluates were submitted for mass spectrometry analysis ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were counted and resuspended in PI solution containing 3/50 volume of 50X PI (Sigma-Aldrich), 1/40 volume of 10 mg/mL RNAaseA (Thermo Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mM DTT) for 8 L of growth and protease inhibitor cocktail (Cat. No. P8849, Sigma-Aldrich) was added ...