Labshake search
Citations for Millipore Sigma :
6851 - 6900 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: Erythrocytes were washed 3 times with an equal volume of RPMI-1640 media (Sigma-Aldrich, SKU R4130) supplemented with ...
-
bioRxiv - Bioengineering 2021Quote: ... scaffolds (n = 3) were submerged into 500 μL of 4 M guanidine hydrochloride (GuHCl, Sigma-Aldrich, Canada) buffer supplemented with a protease inhibitor (Roche Applied Science ...
-
bioRxiv - Bioengineering 2021Quote: ... 48 h and day 21 hBMMSC-seeded scaffolds (n=3) were fixed in 4% paraformaldehyde (Sigma, Canada) for 1 hour and submerged in gradient sucrose solutions from 10% to 30% ...
-
bioRxiv - Microbiology 2020Quote: ... while the upper one (22×40 mm Marienfeld) was functionalized with 3-(Trimethoxysilyl)propyl methacrylate (Sigma-Aldrich) following the standard procedure ...
-
bioRxiv - Plant Biology 2021Quote: ... This solution was replaced with 800 μl of 0.01% ruthenium red solution (11103-72-3, Sigma-Aldrich). The seeds were again shaken vigorously on an orbital shaker for 1 h ...
-
bioRxiv - Cell Biology 2019Quote: ... MCMBP degradation was achieved by the addition of indole-3-acetic acid (IAA; Sigma-Aldrich, I5148-10G) in final concentration 0.5 mM in fresh DMEM media ...
-
bioRxiv - Microbiology 2021Quote: ... The mCherry plasmid was created by cloning mCherry into the multiple cloning site of pTriEx-3 (Novagen) using the Gibson Assembly Cloning Kit (New England BioLabs) ...
-
bioRxiv - Biophysics 2021Quote: ... The bottom slides are silanized by dipping them in a solution of (3-aminopropyl)-trimethoxysilane (Sigma-Aldrich) 0.1% v/v for 30 minutes in ethanol ...
-
bioRxiv - Microbiology 2021Quote: ... The membrane was washed 3 times with PBS with 0.01% Tween®20 (Sigma, St. Louis, MO). Secondary antibody was incubated at room temperature protected from light for 1 hour in Intercept®(TBS ...
-
bioRxiv - Neuroscience 2019Quote: ... slices were washed 3 times in PBS and incubated in PBS-0.1% TritonX-100 (Sigma-Aldrich, Germany) for 2 h under gently shaking ...
-
bioRxiv - Neuroscience 2019Quote: ... with 3-12% sucrose in high pressure liquid chromatography (HPLC)-grade distilled water (Sigma Aldrich; Ca#270733). Dissected whole brains were then transferred to fresh fixative and left overnight in a dark cupboard at RT ...
-
bioRxiv - Physiology 2021Quote: ... rinse 3 times in 1XPBS without detergent and stained with Nile red (Cat. No. 72485, Sigma-Aldrich) or Bodipy™ 493/503 (Cat ...
-
bioRxiv - Plant Biology 2020Quote: ... a DNA oligonucleotide reverse complement to U6 was 3’-end-labelled with Digoxigening-11-ddUTP (Sigma, USA) using a Terminal Deoxynucleotidyl Transferase (TdT ...
-
bioRxiv - Zoology 2021Quote: 200 mg Et-IPA (a-Ethyl-3-hydroxy-2,4,6-triiodohydrocinnamic acid, CAS 96-84-4, Sigma Aldrich) was dissolved in 4 ml edible corn oil ...
-
bioRxiv - Systems Biology 2020Quote: ... We changed medium 2 days later (Day -2) with addition of 3 μg/mL Doxycycline (Sigma D9891) to induce the NIL transcription factors ...
-
bioRxiv - Microbiology 2020Quote: ... roots were hand sectioned from 3 cm above the tips and stained with 0.2% Basic Fuchsin (Sigma). To image GFP and Basic Fuchsin fluorescence ...
-
bioRxiv - Cancer Biology 2020Quote: ... wells were washed three times as quickly as possible with ice-cold blood bank saline and lysed on the dish with 700μL of (4:3) methanol:0.88% KCl in water with 0.25μg/mL tridecanoic acid (Sigma, T0502) to use as an internal extraction standard ...
-
bioRxiv - Cell Biology 2021Quote: ... which was chilled and mixed with 3 μl of cold thrombin (at 100 U/ml; Sigma-Aldrich) just before pipetting into the agarose casting troughs ...
-
bioRxiv - Bioengineering 2021Quote: ... was added to the PEG solution followed by the addition of 1-[bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxide hexafluorophosphate] (HATU; 2.43 g, 6.4 mmol, 2 eq.; Sigma-Aldrich). Next ...
-
bioRxiv - Bioengineering 2020Quote: ... Cells were blocked for 1 hour with 3% BSA and permeabilized with 0.3% Triton X-100 (Sigma). Cells were labeled with rabbit anti-OCT3/4 antibody (sc-9081 ...
-
bioRxiv - Biophysics 2020Quote: ... resulting in a hydrophobic surface for sandwiching the curing hydrogel or with 3-(Trimethoxysilyl)propylmethacrylate (Sigma Aldrich) resulting in free methacrylate groups for crosslinking of PEGDA hydrogels to the surface.
-
bioRxiv - Biophysics 2020Quote: ... The slides were subsequently incubated in methanol containing with 1% (v/v) 3-Aminopropyltriethoxysilane (APTES, Sigma, USA) and 5% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Polη (5’GCAAUGAGGGCCUUGAACA3’ from sigma-Aldrich) and Rev1 (5’CAGCGCAUCUGUGCCAAAGAA3’ from Sigma-Aldrich). For control ...
-
bioRxiv - Cell Biology 2021Quote: ... The membrane was blocked with tris-buffered saline containing 3% bovine serum albumin (cat. A7030, Sigma-Aldrich) and 0.1% Tween 20 (P1379 ...
-
bioRxiv - Cell Biology 2022Quote: ... Nick translation efficiency was checked for by running 3 μl probe on a 1% agarose gel (Sigma). The rest of the probe was cleaned-up with the Zymoclean Gel DNA Recovery Kit (Zymo Research) ...
-
bioRxiv - Biophysics 2022Quote: ... The region in the stencil was treated with (3-aminopropyl)triethoxysilane (APTES, Sigma-Aldrich, cat. no. A3648) diluted at 5% in absolute ethanol for 3 min ...
-
bioRxiv - Biochemistry 2022Quote: ... and concentrated to 13.7 mg·ml-1 (A280=23.36) using a centrifugal filter (Amicon Ultra-0.5, MWCO 3 kDa, Merck Millipore) prior to crystallization ...
-
bioRxiv - Neuroscience 2022Quote: ... brain slices were blocked for 2h at RT (3% normal donkey serum [Sigma D9663], 0.1% triton-x), stained with 1’ ab for 12h at 4°C (EMD Millipore [ab144P ...
-
bioRxiv - Neuroscience 2022Quote: ... Endo-(±)-α-(Hydroxymethyl)benzeneacetic acid 8-methyl-8-azabicyclo[3.2.1]oct-3-yl ester (atropine) and 8-Cyclopentyl-1,3-dimethylxanthine (CPT) were from Sigma. Picrotoxin from Indofine Chemical Company (Hillsborough ...
-
bioRxiv - Immunology 2022Quote: ... 2- or 3-days post fertilisation (dpf) zebrafish were anaesthetised in 0.168 mg/ml Tricaine (Sigma-Aldrich) in E3 media and visualised under a dissecting microscope ...
-
bioRxiv - Pathology 2022Quote: ... 3% BSA) and re-suspended (500µL per kidney) in low salt buffer (20mM HEPES-KOH, Sigma Aldrich #H0527 ...
-
An in vitro neuronal model replicating the in vivo maturation and heterogeneity of perineuronal netsbioRxiv - Neuroscience 2022Quote: ... Non-specific binding sites were blocked by incubation with 3% (v/v) normal donkey serum (Sigma #D9663) in 1X Tris buffered saline (TBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... washed three times in PBS and blocked in a solution containing 3% bovine serum albumin (BSA; Sigma), 5% horse serum (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... ADC scaffolds (n = 3) were gently agitated in 4 M guanidine hydrochloride buffer (GuHCl, Sigma-Aldrich, Canada) supplemented with a protease inhibitor (Roche Applied Science ...
-
bioRxiv - Cancer Biology 2022Quote: ... the slabs were incubated with or without 3 ng/ml ACTH1-24 (Synachthen, Sigma-tau Arzneimittel GmbH) for 24 h ...
-
bioRxiv - Immunology 2022Quote: ... and concentrated to 3 mg/ml using the Amicon ultrafiltration units with 10 kDa cutoff (EMD Millipore).
-
bioRxiv - Physiology 2022Quote: ... To visualize traces the probes were covered with fluorescent (green light) dye (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Sigma). LFP signals from the probes were acquired using a Digital Lynx amplifier (Neuralynx ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... with He gas flow adjusted to 90 PSI and 3 µm pore filter paper (Millipore, Billerica, MA). The gene gun barrel was placed approximately 2.5 cm away from the sample and dye was delivered directly onto the slice ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mM MgCl2) using Amicon Ultra-0.5 mL Centrifugal Filters (30 or 100 K MWCO, Merck Millipore). After re-measuring the concentrations by densitometry ...
-
bioRxiv - Bioengineering 2022Quote: ... donor one and donor three LSECs were harvested from the flasks by adding 3 mL trypsin (Sigma) for 2-3 minutes at 37°C to detach the cells from the monolayer ...
-
bioRxiv - Biochemistry 2022Quote: ... Either Phosphorylcholine 2mM (Avanti) or a combination of DMPC and DMPG (7:3 molar ratio) (Avanti/Sigma) were resuspended in Chloroform:Methanol (95:5 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cleared extracts were mixed 3:1 (v/v) with 3x NuPAGE LDS/DTT Sample buffer (Sigma Aldrich) and boiled at 95°C for 5 minutes ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were trypsinized and resuspended in BD FACS flow buffer supplemented with 3 μM propidium iodide (Sigma). Propidium iodide exclusion was analyzed by flow cytometry.
-
bioRxiv - Cell Biology 2022Quote: ... or for 3 h either with 25 µl of M2 anti-FLAG affinity gel (A2220, Sigma-Aldrich) or RFP-Trap Agarose (rta-10 ...
-
bioRxiv - Biochemistry 2020Quote: ... before Rab8a was washed 3 times with PBS in an Amicon filter (Merck Millipore, 10 kDa NMWL). Incorporation of label was confirmed by MS.
-
bioRxiv - Neuroscience 2021Quote: ... volumes of 3 ml of a set of 48 monomolecular odorants (Sigma-Aldrich, St. Louis MO, USA) were pipetted freshly for each experimental day into 15 ml glass vials (27160-U ...
-
bioRxiv - Biochemistry 2021Quote: ... cell viability was determined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma-Aldrich, MO) as described previously.52 Equivalent MTT assays were performed on cells cultured in the same ratios of PBS to media ...
-
bioRxiv - Molecular Biology 2020Quote: ... Libraries were PCR-amplified with 10-12 cycles using KOD Hot Start DNA polymerase (Millipore, 71086-3) and cleaned up using 1X KAPA Pure Beads ...
-
bioRxiv - Microbiology 2021Quote: ... sporozoites were added to 1 ml molten 3% agarose (2-Hydroxyethyl agarose – Sigma-Aldrich, dissolved in ddH2O), centrifuged and incubated at 4°C for 5 min ...
-
bioRxiv - Neuroscience 2020Quote: ... were washed 3 times in PBS+ 0.1% Tween (PBST) using a magnetic stand (Millipore, PureProteome Cat# LSKMAGS08), CryAB antibody (400μl ...