Labshake search
Citations for Millipore Sigma :
601 - 650 of 10000+ citations for 3 3 17 17 Bis ethylenedioxy 19 hydroxyandrost 5 ene 19 d2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... Aqueous silk was lyophilized and then dissolved in a 17% hexafluoroisopropanol solution (Sigma-Aldrich, St. Louis, MO) overnight ...
-
bioRxiv - Plant Biology 2021Quote: ... ∼10-15 seedlings were transferred to fresh solid MS containing 20µM 17-ß- estradiol or DMSO (Sigma). For heat-shock experiments ...
-
bioRxiv - Cancer Biology 2022Quote: The RIP assay was performed using a Magna RIPTM RNA Binding Protein Immunoprecipitation Kit (17-700; Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: The cytoskeletal fraction was separated using the ProteoExtract® Cytoskeleton Enrichment and Isolation Kit (17-10195; Millipore), following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were further purified by centrifugation over a Percoll gradient (GE Healthcare, 17-0891-01, Sigma Aldrich).
-
bioRxiv - Cancer Biology 2022Quote: ChIP experiments were performed using EZ-Magna ChIPTM A/G Chromatin Immunoprecipitation Kit (Merck Millipore, 17-10086) according to the manufacturer’s procedures ...
-
bioRxiv - Immunology 2020Quote: ... After 17 hours of infection cells were labelled with 1 mg/ml FITC-Dextran 40S (Sigma Aldrich) and incubated for 1 hour at 37°C and 4°C ...
-
bioRxiv - Developmental Biology 2021Quote: ... Immunoprecipitation was performed using manufacturer’s instructions for the EZ-Nuclear RIP Kit (EMD Millipore, #17-10 523), followed by cDNA synthesis and qRT-PCR for 5’ETS ...
-
bioRxiv - Molecular Biology 2023Quote: ... primary antibodies were applied: Anti-O-GlcNAc Transferase (DM-17, Sigma-Aldrich, catalogue number O6264, 1:5000), RL2 (Novus ...
-
bioRxiv - Microbiology 2023Quote: RNA-binding protein immunoprecipitation (RIP) was conducted using the Magna RIP kit (catalog no. 17-700; Millipore) following the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... Cells were then serum starved and pre-treated with 17 β-estradiol (1 mM, Sigma, Waltham MA) or vehicle for 24 hours followed by 8 hours of recombinant TNFα (2ng/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... The clarified lysate was incubated with 500 μl of glutathione-Sepharose 4B (Sigma, Cat#17-0756-01), preequilibrated with 1X PBS containing 0.1% Tween 20 and 5% glycerol (binding buffer) ...
-
bioRxiv - Cancer Biology 2023Quote: ... gamma-h2AX levels were measured for conditions indicated in figures using manufacturer’s protocol (Sigma, no. 17-344). 200k cells were used per replicate per condition and assay was run in technical triplicate per condition.
-
bioRxiv - Immunology 2024Quote: ChIP experiments were strictly performed according to the manual for the ChIP Assay Kit (#17-10086, Millipore) and the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... then mixed with 200 µL of anion exchange resin (Q Sepharose Fast Flow; Sigma #17-0510-10) pre-washed in Lysis buffer at pH 3 ...
-
bioRxiv - Plant Biology 2024Quote: ... chloral hydrate solution was prepared by mixing 1000 g of chloral hydrate (Sigma-Aldrich- 302-17-0) in 400 ml de-ionized water (takes several hours to dissolve) ...
-
bioRxiv - Synthetic Biology 2024Quote: RAS-GTP levels were measured using a Ras Activation ELISA assay kit (Merck Millipore cat.no. #17-497) according to the manual ...
-
bioRxiv - Cell Biology 2024Quote: MeRIP m6A-PCR was performed by using commercially available Magna MeRIP TM m6A kit (Millipore, 17-10499) according to the manufactural protocol ...
-
bioRxiv - Neuroscience 2020Quote: Geosmin (CAS #16423-19-1) was used at a concentration of 1:1000 (Sigma-Aldrich, St. Louis, USA, Product Number UC18). 1-Methylindole (CAS #603-76-9 ...
-
bioRxiv - Neuroscience 2020Quote: ... myotube compartments were treated with 19 μM of the AChR competitive antagonist tubocurarine hydrochloride pentahydrate (DTC) (Sigma, Cat N° T2379-100G) 10 min before analysis ...
-
bioRxiv - Biophysics 2020Quote: ... imaging was performed in a PBS based imaging buffer based on the dSTORM buffer described by van de Linde and others (19) containing 100 mM MEA (Sigma-Aldrich), 0.6 mg/mL Glucose Oxidase (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were incubated for 30 minutes at 37°C in a humidified incubator in 50 µl of monomer solution containing 19% sodium acrylate (Sigma, 408220), 10% acrylamide ...
-
bioRxiv - Microbiology 2021Quote: ... Permeabilized cells were incubated in primary antibodies diluted in blocking buffer for 1hr (1:1000 PR8 NP polyclonal, gift from Dr. Adolfo Garcia-Sastre; 1:1000 γ-tubulin DQ-19, #T3195 Sigma; 1:1000 α-tubulin ...
-
bioRxiv - Cell Biology 2022Quote: ... Conditional degradation of mAID tagged EWSR1 protein in the AUX treated OsTIR7-19 cells was confirmed by Immunocytochemistry and Western blot analysis using anti-FLAG (Sigma, #F7425) and anti-EWSR1 (Santa Cruz ...
-
bioRxiv - Immunology 2022Quote: ... hamsters were injected intraperitoneally with either PBS or 150 mg/kg and 100 mg/kg of cyclophosphamide (CAS: 6055-19-2; PHR1404; Sigma Aldrich) at 3 and 1 days before SARS-CoV-2 infection ...
-
bioRxiv - Cell Biology 2023Quote: ... VeroE6 cells were transfected with pHLARE plasmids alone and then after 16 hours were treated with either 200 nM BafilomycinA1 (19-148) from Sigma-Aldrich for 150 minutes ...
-
bioRxiv - Genomics 2024Quote: ... and 19 (clones: C-11, PCK-26, CY-90, KS-1A3, M20, A53-B/A2, C2562, Sigma, St. Louis, MO, USA), mouse IgG1 anti-human CK 19 (clone ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4% 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS, Sigma)] ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 3’-diaminobenzidine tetrahydrochloride hydrate (DAB) (Sigma SIG-32750) in sodium acetate ...
-
bioRxiv - Bioengineering 2021Quote: ... 3- [(3- Cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS, Sigma RES1300C), digitonin (Sigma D141) ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by 3-3’ diaminobenzidine tetrahydrochloride (DAB, Sigma Aldrich) staining ...
-
bioRxiv - Microbiology 2022Quote: ... 3-amino-9-ethylcarbazol (3-AEC; Sigma Aldrich, Germany) was used as a chromogen ...
-
bioRxiv - Microbiology 2021Quote: ... 3-Amino-1,2,4-triazole (3-AT, A8056, Sigma Aldrich). Bovine liver catalase (C1345 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 µM CHIR99021/GSK-3 Inhibitor (Millipore Sigma 361571), and 1 µM PD0325901/MEK1/2 Inhibitor (Millipore Sigma 444968 ...
-
bioRxiv - Microbiology 2021Quote: ... 3-(3-hydroxy-phenyl)propionate (Sigma Cat Number PH011597) and 3-hydroxycinnamic acid (CAS Number 14755-02-3) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.05% 3-3′ diaminobenzidine tetrahydrochloride hydrate (DAB, Sigma D5637) and 4% sucrose in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... Interleukin-3 (IL-3, Cat# SRP4135-10UG, Sigma, USA), Alexa Fluor 488 EGF complex (Cat# E13345 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and 0.5 nM neurotrophin-3 (NT-3, Sigma #SRP6007). Cells were released by trituration through fire-polished glass pipettes of decreasing diameter ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mg/ml 3′,3′-diaminobenzidine tetrahydrochloride hydrate (Sigma), 24 units/ml catalase from bovine liver (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... and activating transcription factor 3 (ATF-3, HPA001562, Millipore). After three washes with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 mM 3-methoxybenzylamine (3-MBZ, Sigma-Aldrich #159891), and 0.5 mM benzylamine (BZA ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5 mM Bis-Tris (Sigma B4429). Half of the total dissected discs were transferred to 24-well tissue culture dishes containing this prepared media + 5 ∝g/mL Actinomycin D ...
-
bioRxiv - Molecular Biology 2021Quote: ... gallinamide A-bound cruzain was concentrated to 10 mg/mL and the activation buffer was exchanged to 2 mM Bis-Tris pH 5.8 using a centrifugal filter with molecular weight cut-off of 3 kDa (Millipore). For cruzain-gallinamide A analog complexes ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatment of mice were performed with a single intraperitoneal injection of either vehicle (corn-oil) or 3 mg/kg 1,4-bis-[2-(3,5,-dichloropyridyloxy)] benzene (TCPOBOP, T1443, Sigma-Aldrich).
-
bioRxiv - Cell Biology 2022Quote: ... Sin1 (3-(4-5 Morpholinyl) sydnone imine hydrochloride (Sigma-Aldrich, Cat-M5793). Media products MEM and F12 (ratio 1:1) ...
-
bioRxiv - Cell Biology 2021Quote: ... the 3’UTR of Pol κ (Polκ3’) (5’ACUCCAGCCUGAAGAGCGA3’ from Sigma-Aldrich), USP7 (5’CCCAAAUUAUUCCGCGGCAAA3’ from Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... washed 3 × 5 min in PBS with 0.1% Tween (both Sigma Aldrich) and probed for 1 h at room temperature in the dark with IRDye® conjugated secondary Abs against goat IgG (800CW ...
-
bioRxiv - Immunology 2021Quote: ... Scrambled non-targeting siRNA (5’-AAUUCUCCGAACGUGUCACGU-3’) was used as control (Sigma). Briefly ...
-
bioRxiv - Molecular Biology 2023Quote: ... siRNA sequences (5’ – 3’) are the following: Universal siRNA control (Sigma, SIC001)
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 mM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Sigma, No.B7880) and 0.1 mM 3-Isobutyl-1-methylxanthine (IBMX ...