Labshake search
Citations for Millipore Sigma :
451 - 500 of 10000+ citations for 3 3 17 17 Bis ethylenedioxy 19 hydroxyandrost 5 ene 19 d2 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2024Quote: ... 3-aminobenzamide (3-AB; Sigma-Aldrich) was dissolved in DMSO to a stock of 100 mM ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Bixafen, (N-(3’,4’-dichloro-5-fluorobiphenyl-2-yl)-3-(difluoromethyl)-1-methylpyrazole-4-carboxamide) (Bixafen, (Sigma-Aldrich, St ...
-
bioRxiv - Plant Biology 2023Quote: ... SD-WLH plates were supplemented with either 2.5 or 5 mM 3-amino-1,2,4-triazole (3-AT, Sigma-Aldrich).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... for 1h and subsequently developed using 2,2-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid) substrate (Sigma). Absorbance was measured at 405nm in a BioTek Synergy HTX multi-mode reader ...
-
bioRxiv - Bioengineering 2022Quote: ... USA) and subsequently submerged in a solution of 2% bis[3-(trimethoxysilyl)propyl]amine (Sigma-Aldrich), and 1% DI-water in IPA at 80°C for 20 minutes following previously published protocols 67 ...
-
bioRxiv - Biochemistry 2024Quote: ... The diluted proteins were incubated with primary amine reactive 3 mM (final) bis(sulphosuccinimidyl)suberate (Sigma) and 20 µL of the sample was taken at various time points (0 ...
-
bioRxiv - Biophysics 2020Quote: ... d2 (Sigma Aldrich, 596388) was added to the reaction with or without the copper treatment ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA probes (5’-GTTATGAGCCCGACGAGCTACCAGGCTGCT-3’) with a 5’-ethylcarbamate amino linker (Sigma-Aldrich) were covalently immobilized on NHS-activated Sepharose 4 Fast Flow (GE Healthcare ...
-
bioRxiv - Cancer Biology 2021Quote: RIP assay was performed using the Magna RIP RNA IP kit (17–700) from Millipore according to manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... The following antibodies were used (4 μg/sample): H3K27me3 (Upstate/Millipore, cat. no. 17-622), EZH2 (Upstate/Millipore ...
-
bioRxiv - Molecular Biology 2021Quote: ... EEF1A1 primer sequences were obtained from the Magna MeRIP m6A kit (17-10499, Sigma-Aldrich). Sequences for Luciferase primers (LucR2 ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: RIP assays were performed using a Magna RIP™ Kit (Millipore, #17-700; Darmstadt, Germany) according to the instruction provided by the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Huh7 and WCH-17 cells were maintained in DMEM (Wako) containing 10% FBS (Sigma Aldrich), 100 unit/ml penicillin (Meiji) ...
-
bioRxiv - Genetics 2020Quote: ChIP was performed using the EZ-ChIP™ Chromatin Immunoprecipitation Kit (Cat# 17-371, Millipore) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Kolliphor EL and 0.9% (w/v) NaCl (2:1:17; all Sigma-Aldrich, Poole, UK) was administered twice daily over five days via intraperitoneal (i.p. ...
-
bioRxiv - Molecular Biology 2022Quote: ChIP assays were performed using a ChIP assay kit (Millipore EZ-CHIP 17-371, USA) according to the manufacturer’s instructions38 ...
-
bioRxiv - Genetics 2024Quote: ... The precleared chromatin sample was incubated with 0.5 μg of anti-H3K4me3 (Millipore 17-614) or 1 μg anti-nucleosome (58 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... at 10 nM or for two days with 17-ß estradiol (E2) (Sigma Aldrich, E8875) at the same concentration following by two days with progesterone (P4 ...
-
bioRxiv - Immunology 2024Quote: PP2A enzymatic activity was assessed using the PP2A Immunoprecipitation Phosphatase Assay Kit (17-313; Millipore) per the manufacturer’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... The precleared chromatin sample was incubated with 0.5 μg of anti-H3K4me3 (Millipore 17-614) or 0.75 μg anti-H3K36me3 (Cell Signaling #4909 ...
-
bioRxiv - Immunology 2023Quote: ... Beads were washed 6 times with ice-cold RIP wash buffer (Millipore, cat#17-700). RNA was extracted using RNAzol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Leukocytes were enriched by centrifugation with 40% Percoll plus (Millipore Sigma, Cytiva 17-5445-02). Blood samples were collected from the heart with a 1-mL syringe ...
-
bioRxiv - Neuroscience 2023Quote: ... or LentiBrite RFP Control Lentiviral Biosensor (Millipore, #17-10409, titer 4.59 x 108 IFU/mL) at MOI of 20 for 24 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... and brain samples were subjected to 33-40% Percoll gradient (Sigma-Aldrich #17-0891-01) to remove myelin then resuspended in red blood cell (RBC ...
-
ALS iPSC-derived microglia and motor neurons respond to astrocyte-targeted IL-10 and CCL2 modulationbioRxiv - Neuroscience 2023Quote: ... or LentiBrite RFP Control Lentiviral Biosensor (Millipore, #17-10409, titer 4.59 x 108 IFU/mL) at MOI of 20 for 24 hours ...
-
bioRxiv - Genomics 2023Quote: ... peripheral blood mononuclear cells (PBMCs) were isolated using 63% Percoll (Sigma, Cytiva;17-0891-01) solution ...
-
bioRxiv - Pathology 2024Quote: ... mouse anti-17-smooth muscle actin-Cy3-conjugated antibody (Sigma, C6198/F3777; 1:2000 dilution), (3 ...
-
bioRxiv - Cell Biology 2024Quote: The H2AX phosphorylation (γH2AX) for fluorescence-activated cell sorting (FACS) kit (Sigma-Aldrich, 17-344) was used to prepare cell samples following the manufacturer’s protocol for fixation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 µM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone; SIGMA, USA) at a 23.7×108 cfu/ml (OD600=0.75 ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 × 5 minutes each and were mounted using Fluorosave (Millipore) before imaging ...
-
bioRxiv - Immunology 2021Quote: ... siRNA-TDP-43 D: 5’-GAAACAAUCAAGGUAGUAA[dT][dT]-3’ (Sigma)4 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 100 µM acetosyringone (3′,5′-dimethoxy-4′-hydroxyacetophenone, Sigma D134406), and incubated for 6h at 28°C at 150 rpm.
-
bioRxiv - Microbiology 2021Quote: ... 5 × 10−3 g/L human insulin (Sigma Aldrich, USA), 5 × 10−5 M hydrocortisone (Upjohn Laboratories SERB ...
-
bioRxiv - Microbiology 2020Quote: ... Reverse Primer 5’-TGGTTGAGCACAGGGTACTT-3’] were synthesized by Sigma-Aldrich, USA ...
-
bioRxiv - Plant Biology 2020Quote: ... 200 μM 3′,5′-Dimethoxy-4′-hydroxyacetophenone (acetosyringone) (SIGMA, USA) carrying the corresponding binary plasmids (Table 1) ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgCl2 and phosphatase (phosphatase inhibitor cocktail 3, Sigma) and protease inhibitors (EDTA free cOmplete™ protease inhibitors ...
-
bioRxiv - Biochemistry 2021Quote: ... 5-Bromo-4-Chloro-3-Indolyl-phosphate (BCIP, Sigma B8503) was used as the chromogenic substrate.
-
bioRxiv - Cell Biology 2021Quote: ... (3) TGFβ2 (5 ng/ml) + GsMTx4 (500 nM; Sigma-Aldrich), or (4 ...
-
bioRxiv - Physiology 2022Quote: ... 3 nM 3,3’,5-Triiodo-L-thyronine sodium salt (Sigma), 10 ng/ml EGF (Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The membranes were blocked in 3-5% skimmed milk (Sigma) dissolved in Tris buffered saline + 0.2% v/v Tween-20 (TBST) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 2’-O-dibutyryladenosine 3:5-cyclic monophosphate (dbcAMP; Sigma-Aldrich), and 0.1 mM 3-isobutyl-1-methyl xanthine (IBMX ...
-
bioRxiv - Cell Biology 2023Quote: ... 5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside (Sigma) was used at a final concentration of 1mg/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... and BCIP (5-bromo-4-chloro-3-indolyl-phosphate; Sigma).
-
bioRxiv - Immunology 2024Quote: ... reverse primer (5’-3’): GACGGTGCCATGGAATTTGC) and purchased from Sigma-Aldrich. RT-qPCR was performed with gene-targeted primers using TB Green Premix Ex Taq II (Tli RNase H Plus ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mM 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added 1 h prior to adding phleomycin or β-estradiol.
-
bioRxiv - Cancer Biology 2024Quote: ... cells were exposed to 3-Methyladenine (5 mM; Sigma, M9281) for 24 hours ...
-
bioRxiv - Microbiology 2022Quote: ... with Kropat’s trace elements except for selenium (Kropat et al. 2011) + 1000 ng·L-1 cyanocobalamin (CAS 68-19-9, Millipore-Sigma) agar (1.5% ...
-
bioRxiv - Bioengineering 2024Quote: ... mix 1 mL of 3.34 mM [Ca] solution (from CaCl2) with 1 mL of 19 mM [P] solution (a mixture of Na2HPO4 (Sigma) and 300 mM NaCl (Sigma)) ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-Isobutyl-1-methylxanthine (15879) and 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (B7880) were purchased from Sigma. Phosphodiesterase inhibitor Tocriset containing Milrinone ...