Labshake search
Citations for Millipore Sigma :
6351 - 6400 of 10000+ citations for Recombinant Human Pentraxin 3 Long His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Differentiation media was supplemented with 2ng/ml BMP4 and 3 µmol Thiazovivin (Millipore). embryoid bodies were cultured in 6cm dishes (USA Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were blocked for 1 hour at room temperature (3% BSA (Sigma, A3803) in D-PBS) ...
-
bioRxiv - Pathology 2021Quote: ... with the addition of blocking endogenous peroxidase activity with 3% H2O2 (Sigma Aldrich) in ddH2O after epitope retrieval ...
-
bioRxiv - Biochemistry 2021Quote: ... The samples were then washed using water and 3-kDa filters (Millipore Sigma) to remove any guanidine hydrochloride ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were stained during 3 hours with 0.5% w/v Victoria Blue (Sigma) in acid alcohol and after staining embryos were washed in acid alcohol until the embryos were white ...
-
bioRxiv - Developmental Biology 2021Quote: ... Embryos were mounted on the 3% Methyl cellulose (Sigma Aldrich, cat no. M0512) and imaged on an Axioplan Microscope (Zeiss ...
-
bioRxiv - Immunology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Sigma, 28718-90-3, St Louis, MO, USA). The results were recorded using Zeiss LSM780 confocal system (Zeiss ...
-
bioRxiv - Biophysics 2020Quote: ... MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide, p# M5655, Sigma-Aldrich) was dissolved in Phosphate Buffer Solution (PBS ...
-
bioRxiv - Cell Biology 2020Quote: ... cultures were supplemented with auxin (Indole-3-acetic acid sodium salt, Sigma I5948) to final concentrations of 500 µM ...
-
bioRxiv - Genomics 2021Quote: Total RNA was extracted from 3×106 HeLa cells using TRIzol (Sigma, T9424). Prior to submission for high-throughput sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... we fixed 100mL of mid-exponential LSUCC0096 culture with 3% glutaraldehyde (Sigma Aldrich) and stored at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... Depletions were induced by 3 days exposure to 2.5 μg/ml doxycycline (Sigma) as described (19) ...
-
bioRxiv - Immunology 2021Quote: ... 100 ml/well of 3 mg/ml paranitrophenyl-phosphate disodium hexahydrate (Sigma Aldrich) in 1 M diethanolamine buffer pH 9.8 and plates were incubated at room temperature in the dark for 45min ...
-
bioRxiv - Genomics 2020Quote: ... Samples were washed with TLE 3 times in 30KDa amicon columns (MilliPore # UFC5030BK). Both SisterC and Hi-C libraries were then enriched for biotin-containing fragments by pull down with MyOne Streptavidin C1 beads (Life Tech #65-001) ...
-
bioRxiv - Neuroscience 2020Quote: ... washed 3 times in 0.3% PBST (0.3% Triton-X100 in PBS, Sigma-Aldrich), blocked in 5% goat serum (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... The probe used was as follows: 5’[6FAM]AGACTAATTCTCCTCGGCGGGCACG[TAM]3’ (Sigma Aldrich). Analysis was performed using the Rotor-Gene 6000 Series Software 1.7 (Corbett Life Sciences ...
-
bioRxiv - Immunology 2021Quote: ... and 3 weeks later with the same material in incomplete Freund’s adjuvant (Sigma). Mice were boosted both intravenously and intraperitoneally 2 weeks later with 20 μg of the same antigen in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (Sigma-Aldrich). Air-dried plates were read ...
-
bioRxiv - Immunology 2021Quote: ... permeabilized and blocked with PBS containing 3% bovine serum albumin Fraction V (Sigma), 0.2M Triton X-100 ...
-
bioRxiv - Developmental Biology 2020Quote: ... washed 3 times in M9 and frozen at −80°C in Trizol (Sigma) before RNA preparation ...
-
bioRxiv - Developmental Biology 2020Quote: ... washed 3 times with 1X PBS and mounted with Fluoroshield with DAPI (Sigma). Images were acquired with a Nikon Perfect Focus Eclipse Ti live-cell fluorescence microscope ...
-
bioRxiv - Bioengineering 2020Quote: ... MMP-3 was activated in 0.1 mM P-Aminophenylmercuric acid (#164610, Milipore Sigma) at 37 °C for 24 hours ...
-
bioRxiv - Genomics 2020Quote: ... and subsequently hybridized with a biotin-labeled (TTAGGG)3 probe synthesized by Sigma. The North2South® Chemiluminescent Hybridization and Detection Kit (Thermo Fisher ...
-
bioRxiv - Cell Biology 2021Quote: ... acidified to a final concentration of 0.5% trifluoroacetic acid (pH < 3, Sigma, AAA1219822) and desalted by reversed phase C18 solid phase extraction (SPE ...
-
bioRxiv - Cell Biology 2021Quote: ... and incubated in 3 mg/mL RU486 (in 80 % ethanol, M8046, Sigma Aldrich) for 10 min to activate the geneswitch ...
-
bioRxiv - Neuroscience 2020Quote: ... prior to 3 final PBS washes and mounting in FluorSave reagent (Millipore Sigma).
-
bioRxiv - Neuroscience 2022Quote: ... in maturation media (Supplementary Table 3) supplemented with 2ug/mL doxycycline (Sigma, D3447). Half of the media was then replaced with maturation media after 7 days ...
-
bioRxiv - Developmental Biology 2022Quote: ... the nitrocellulose membranes were incubated in blocking buffer with 3 % gelatin (Sigma-Aldrich) in TTBS buffer (Tris-buffered saline ...
-
bioRxiv - Biochemistry 2022Quote: ... 2.5mM Na3VO4 and 1% each of phosphatase inhibitor cocktails 2 and 3 (Sigma) and set on ice for 10 minutes prior to sonication ...
-
bioRxiv - Biophysics 2022Quote: ... Proteins were concentrated using a centrifugal filter unit (3 kDa MWCO, Merck Millipore) at 3500 rpm and 4°C ...
-
bioRxiv - Cancer Biology 2022Quote: ... the reagent 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Sigma-Aldrich) was added to the cells and incubated for 4 hours at 37 °C (5 % CO2) ...
-
bioRxiv - Biochemistry 2022Quote: ... 1 mM DTT) and concentrated using a 3 kD MWCO centricon (Merck Millipore). For best performance in the iSAT reaction ...
-
bioRxiv - Bioengineering 2022Quote: ... was mixed with 3 v/v% GOPS (average Mn 236.34, Sigma-Aldrich, Ireland). PEDOT:PSS blends were vortexed for 30 seconds ...
-
bioRxiv - Biophysics 2022Quote: ... the coverslips were salinized by incubation in 1% (3-Aminopropyl) triethoxysilane (APTES) (Sigma) in methanol for 20 min and rinsed thoroughly with methanol and cured for 20 min in the oven for drying ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS were fixed for 3 minutes in Bouin’s fixative solution (Sigma Aldrich, HT10132), and the rest of the protocol was identical ...
-
bioRxiv - Cell Biology 2022Quote: ... The medium was concentrated with a 3-kDa cut-off centrifugal filter (Millipore). Samples were subjected to SDS-PAGE under reducing conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... 350 µg total protein concentrated with 3-kDa cut-off centrifugal filter (Millipore) from serum-free medium was subjected to SDS-PAGE with multiple band excision and in-gel digestion ...
-
bioRxiv - Immunology 2022Quote: ... After blocking with 3% normal Donkey serum with 0.3% Triton X-100 (Sigma) in PBS (RT ...
-
bioRxiv - Genomics 2022Quote: ... before addition of 500 µM indole-3-acetic acid solution (“auxin”, Sigma-Aldrich) for 14 h to induce RPB1 degradation ...
-
bioRxiv - Genetics 2022Quote: ... or 1:3000-diluted antibody against GAPDH (glyceraldehyde 3-phosphate dehydrogenase) (Sigma-Aldrich). After repeated washings ...
-
bioRxiv - Immunology 2022Quote: ... incubated overnight with 3 μg of mouse anti-FLAG antibody (clone M2; Sigma), and then for 10 minutes with 2 μg of rat anti-Ms IgG (clone P3.6.2.B.1 ...
-
bioRxiv - Microbiology 2022Quote: ... The experiment started with the addition of 10 mM glycerol-3-phosphate (Sigma), the mitochondrial glycerol-3-phosphate dehydrogenase substrate ...
-
bioRxiv - Physiology 2022Quote: ... Ketones used for all experiments were (R)-3-Hydroxybutyric acid (Sigma-Aldrich #54920). Citrate used for all experiments was sodium citrate (Sigma-Aldrich #1613859) ...
-
bioRxiv - Microbiology 2022Quote: ... Samples were blocked for 1 h in 3% bovine serum albumin (Sigma-Aldrich) and subsequently incubated in primary antibodies (overnight ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... We then incubated brains in primary antiphosphorylated histone 3 (pH3) (Sigma-Aldrich; H0412) antibody solution (in PBS-0.1% TX-100 ...
-
bioRxiv - Neuroscience 2022Quote: ... buffered with 3 mM N-2-hydroxyethylpiperazine-N’-ethanesulfonic acid (HEPES, Sigma Chemical) and pH adjusted to 7.65 at 15°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... at a ratio of 3:2:1 in HEK 293T cells (Sigma Aldrich) using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... and laminin for 3 hours at 37°C (5 μg/mL, Sigma L2020). To create single cell suspensions for plating aNSCs ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were quenched for endogenous peroxidase activity by incubation in 3% H2O2 (Sigma) diluted in methanol for 10 min at 4□°C ...
-
bioRxiv - Physiology 2022Quote: ... the animals received an IV injection of Evans Blue (Sigma; 3 μl/g) for vascular labelling ...