Labshake search
Citations for Millipore Sigma :
6251 - 6300 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2020Quote: ... The gelatinous egg sack was removed using 3% L-Cysteine (Merck Millipore, Burlington, MA, USA) and followed by microinjection of viral mimics or shRNAs.
-
bioRxiv - Neuroscience 2019Quote: ... for 15 minutes and blocked for endogenous peroxidase with 3% H2O2 (Sigma-Aldrich, MO, USA) for 10 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... and purified cells were cultured in the presence of 3 μg/ml PHA (Sigma-Aldrich) and 10 U/ml IL-2 (Peprotech ...
-
bioRxiv - Microbiology 2020Quote: ... Antibodies were diluted in DMEM high 3 glucose media containing 0.7% Low IgG BSA (Sigma), 1X Sodium Pyruvate ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by 0.05% tetrachlorogold solution (AppliChem) for 3 min and 2.5% sodium thiosulfate (Sigma-Aldrich) for 3 min with three washes after each step using distilled water.
-
bioRxiv - Biochemistry 2020Quote: ... Deionized water was obtained from a MilliQ® Integral 3 instrument (Millipore, Billerica, MA, USA). Ab Spin Trap columns (immobilized protein G ...
-
bioRxiv - Immunology 2020Quote: ... only Group-3 animals were treated with 2 mg/kg Dexamethasone sodium phosphate (Sigma Aldrich) in PBS by subcutaneous injection three times ...
-
bioRxiv - Molecular Biology 2021Quote: Cationic liposomes were prepared with 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP; Merck Millipore, Darmstadt, Germany), 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE ...
-
bioRxiv - Physiology 2021Quote: ... 6 corneas from 3 individuals were pooled in 100 μl of Tri reagent (T9424, Sigma). RNA was isolated from TRI reagent (T9424 ...
-
bioRxiv - Physiology 2020Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay from Sigma (St. Louis, MO), and D-luciferin from Gold Biotechnology (St ...
-
bioRxiv - Microbiology 2020Quote: ... and probed with appropriate antibodies in PBS with 3% milk and 0.1% Tween20 (Sigma-Aldrich). Rabbit and mouse anti-SFP1 serum were used at a dilution of 1:1000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cleared and stained organoids were embedded in 3% low-gelling agarose (A9414, Sigma Aldrich) dissolved in a mixture of CUBIC-2 and PBS (3:1 ...
-
bioRxiv - Microbiology 2021Quote: The NLRP3 inhibitor MCC950 ([vehicle solution DMSO], 10 μM CAS 256373-96-3 – Calbiochem, Sigma), and the caspase 1 inhibitor YVAD ([vehicle solution DMSO] ...
-
bioRxiv - Physiology 2019Quote: ... mice were injected intraperitoneally with either 3 mg/kg TCPOBOP (Sigma-Aldrich, St. Louis, MO) or vehicle (sunflower oil ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Responses were normalized to the fluorescence obtained with calcium ionophore (A23187, 3 μM; Sigma-Aldrich).
-
bioRxiv - Developmental Biology 2020Quote: ... 2-3 fillets of late foraging larvae were incubated in M3 insect medium (Sigma-Aldrich) supplemented with 2 mM of trehalose (Sigma-Aldrich) ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... rats received 0.05 ml of a glycerol locking solution containing 3 parts glycerol (Sigma-Aldrich, St.
-
bioRxiv - Biophysics 2019Quote: ... the slides were incubated in a freshly prepared N-[3-(Trimethoxisilyl)propyl]ethyldiamine (Sigma-Aldrich) solution (2% (v/v ...
-
bioRxiv - Molecular Biology 2019Quote: ... blocked in 3% Bovine Serum Albumin (BSA) and incubated with primary anti-FLAG (Sigma, F1864) at 1:1000 in 1% BSA for 1 hour at room temperature ...
-
bioRxiv - Bioengineering 2019Quote: hMSC condensations (N = 3/group) were homogenized in CelLytic™ MT lysis buffer (Sigma-Aldrich) supplemented with Halt™ protease and phosphatase inhibitor cocktail (Thermo Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... then rigorously vortexed using 3-mm sterile glass beads (Sigma-Aldrich, Saint-Quentin-Fallavier, France) and passed five times through a 25-G needle to disperse clustered cells ...
-
bioRxiv - Cell Biology 2019Quote: ... HeLa cells were transfected with 1.2 µg DNA (total) per 3 µL GeneJuice (Merck Millipore) according to the manufacturer’s instructions ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... Larvae were anesthetized with 160 mg/L of ethyl 3-aminobenzoate methanesulfonate (MS222; Sigma-Aldrich). A 15 seconds video of each larva in the lateral position was then captured ...
-
bioRxiv - Molecular Biology 2019Quote: ... Resumption of meiosis was prevented with 0.2 mM 3-isobutyl-1-methyl-xanthine (IBMX, Sigma). MII oocytes were obtained from animals superovulated with 7 IU of PMSG administered on day 1 and 7 IU of hCG administered 46 – 48 h post PMSG ...
-
bioRxiv - Immunology 2019Quote: ... Coverslips were washed with PBS and coated with 3% human serum albumin (HSA; A1653, Sigma) o.n ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were harvested (5,000 x g; 20 min; 4°C; Sigma 3-16KL; rotor 11180); the spent medium was TCA-precipitated (20% w/v ...
-
bioRxiv - Physiology 2020Quote: ... and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP; Sigma-Aldrich, Gillingham, UK) substrate solution (50 mg/ml BCIP in autoclaved water ...
-
bioRxiv - Microbiology 2020Quote: ... with a 3 kDa molecular weight cut-off ultrafiltration disk (Millipore Sigma; Cat. No.: PLBC06210)] and then dialyzed extensively against water [3.5 kDa molecular weight cut-off dialysis tubing (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... and zebrafish larvae were treated with chloroquine diphosphate (3 mM, Sigma-Aldrich [catalogue number C6628]), two commonly utilised inhibitors of autophagy [32] ...
-
bioRxiv - Physiology 2021Quote: ... They were then given access to bottles with water containing 3% sucrose (Sigma-Aldrich #16104) or pure water ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Standard samples of 3-oxo-C12-HSL and C4-HSL were purchased from Sigma-Aldrich. The cell-free reaction samples were preprocessed using HPLC (Supplementary Methods) ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were harvested by trypsinisation in 3 ml 0.25% trypsin-EDTA solution (Sigma-Aldrich, T3924), which was then inhibited by adding 4 ml of ice-cold KHM buffer (110 mM KOAc ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 12.5 µl of 3 mM 4- methylumbelliferyl N-acetyl-β-D-glucosaminide (Sigma-Aldrich) followed by incubation for 30 min at 37°C ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... brain slices were blocked in a solution containing 3 % donkey serum (DS) (D9663, Sigma-Aldrich) and 0.3 % Triton X-100 (T ...
-
bioRxiv - Biochemistry 2021Quote: ... The 3’ biotinylated TAR and RNA 30-mer (Table 1) were chemically synthesized (Sigma Aldrich). RNA (50 pmol ...
-
bioRxiv - Neuroscience 2021Quote: DIV 3 hippocampal neurons were treated with 1μM of (+)-MK-801 hydrogen maleate (Sigma, M107) for 30 min at 37ºC to reduce spontaneous rod formation ...
-
bioRxiv - Neuroscience 2021Quote: DIV 3 hippocampal neurons were treated with 1μM of (+)-MK-801 hydrogen maleate (Sigma, M107) for 30 min at 37ºC to reduce spontaneous rod formation ...
-
bioRxiv - Neuroscience 2021Quote: ... A single-stranded oligo homology template (5’-ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACG ATGACAAGATGAGCACGGAGGTGAGCTGCCCTCAGGGGCTGTAAGGGACACCTTTGCTG-3’) was synthesized by Sigma Aldrich. The gRNA ...
-
bioRxiv - Neuroscience 2022Quote: ... the 3:1-DMEM/F12-medium was supplemented with 10 μM retinoic acid (Sigma, #R2625), and the medium was daily exchanged ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 0.1% 2-mercaptoethanol) containing 10 µM SB431542 (R&D) and 3 µM CHIR99021 (Sigma), and was subsequently replaced every day ...
-
bioRxiv - Cell Biology 2021Quote: ... Sig8-bromoadenosine 3′,5′-cyclic monophosphate sodium salt (8-Br-cAMP, Sigma-Aldrich, Darmstadt, Germany) at 0 hpi to a final concentration of 0.2 mM ...
-
bioRxiv - Cell Biology 2021Quote: ... coated tissue culture dishes and routinely sub-cultured every 2–3 days using accutase (Sigma) for detachment ...
-
bioRxiv - Immunology 2020Quote: ... Cells were resuspended in flow cytometry buffer (FB: 2% FCS, 3 nM EDTA (Sigma, E9884) in PBS) ...
-
bioRxiv - Microbiology 2020Quote: ... Endogenous peroxidase activity was inhibited using 3% H2O2 in molecular-grade methanol (Sigma-Aldrich, Germany). Slides were washed with phosphate buffered saline (PBS ...
-
bioRxiv - Immunology 2021Quote: ... or 400µg NP-PCC (4-hydroxy-3-nitrophenylacetyl (Biosearch) conjugated to pigeon cytochrome C (Sigma)) mixed with adjuvant based on Monophosphoryl Lipid A ...
-
bioRxiv - Microbiology 2020Quote: ... mouse splenocytes were plated at 3 × 105 / well into 96-well filtration plates (Millipore, USA) pre-coated with capture antibodies and stimulated with 5 µg / well purified JEV or ZIKV particles for 60 h at 37 °C ...
-
bioRxiv - Immunology 2020Quote: ... The DRG cells were then passed over a 3% bovine serum albumin (BSA) (Sigma-Aldrich) gradient and resuspended in Neurobasal-A medium (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... Following enzymes were blocked Histone acetyltransferases by epigallocatechin-3-gallate (EGCG; 15 µM; Sigma-Aldrich), histone methyltransferases by 5′-deoxy-5′-methylthioadenosine (MTA ...
-
bioRxiv - Immunology 2021Quote: ... The plates were developed with commercially available 3-Amino-9-ethylcarbazole (AEC) substrate (Sigma-Aldrich). The observed spots were counted using an ELISPOT plate reader by ZellNet and the final data was reported as spot forming cells (SFC ...
-
bioRxiv - Cell Biology 2020Quote: ... for 3 days and expanded prior to seeding into triple flasks (Nunc® Sigma-aldrich). Expression was induced with 1 μg mL-1 doxycyclin (Sigma-Aldrich ...