Labshake search
Citations for Millipore Sigma :
6501 - 6550 of 9891 citations for SUMO2 3 Blocking Peptide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... Derivatization was carried out using Tri-sil reagent (3-3039 Sylon HTP kit, Supelco, Sigma-Aldrich) at 80°C for 20 min as previously described (42) ...
-
bioRxiv - Microbiology 2019Quote: ... 1,2-distearoyl-sn-glycero-3-phosphoethanolamine-N-[PDP(polyethylene glycol)-2000] (DSPE-PEG-PDP) (Sigma-Aldrich) was mixed with L-α-phosphatidylcholine from egg chicken (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2019Quote: ... and thereafter blocked against non-specific antibody binding with 3% BSA in PBS (Sigma-Aldrich, UK). For staining C ...
-
bioRxiv - Bioengineering 2019Quote: ... A control sample of 1 mg/mL PbS quantum dots (Millipore Sigma, 3 nm nominal size) in toluene was run first to verify measurement accuracy ...
-
bioRxiv - Biophysics 2020Quote: ... 100 µl of a 1:1000 dilution of 3 µm polystyrene beads (LB30, Sigma Aldrich, Germany) were added and after a 3-minute incubation ...
-
bioRxiv - Physiology 2019Quote: ... and T3 (3,3’,5-triiodo-L-thyronine, >95% HPCL, CAS number 6893-02-3, Sigma-Aldrich), first dissolved in 0.1M NaOH and then diluted in 0.9% NaCl ...
-
bioRxiv - Cell Biology 2019Quote: ... Eluted RNAs were concentrated to 80 μL with Amicon spin filters (3 KD cutoff, Millipore UFC500324). Concentrated RNAs were mixed with 40 μL of 3X SDS sample buffer (150 mM Tris ...
-
bioRxiv - Genetics 2021Quote: ... late L4 animals were mock treated or exposed to 1 mM auxin (3-indoleacetic acid, Sigma) for 24 h ...
-
bioRxiv - Genomics 2021Quote: ... Next the cells were blocked with 3% (wt/vol) BSA (Sigma-Aldrich, cat. no. A9647-100G) and 0.2% (vol/vol ...
-
bioRxiv - Biophysics 2021Quote: ... The bottom coverslip was functionalized with an amino-group in the 2% 3-aminopropyltheithoxysilane (440140, Sigma) in acetone for 10 min ...
-
bioRxiv - Cell Biology 2021Quote: The Caspase-3 colorimetric assay was also conducted according to manufacturer instructions (Sigma-Aldrich, MO, USA). 3T3-L1 cells were treated with Bhasma for 0 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.05 % bromophenol blue) and mechanically homogenized using acid-washed glass beads for 3 min (Sigma-Aldrich) then incubated at 95°C for 5 min ...
-
bioRxiv - Bioengineering 2021Quote: Cell pellets and EVs solutions (in 3:1 ratio) were lysed in RIPA buffer (Sigma-Aldrich) containing the Halt Protease Inhibitor Cocktail (Thermo Scientific) ...
-
bioRxiv - Bioengineering 2020Quote: ... the devices were flushed 3 times with 1X DPBS followed by incubation with DAPI (Sigma-Aldrich) diluted in double distilled water by 1:1000 for 3 min to stain for HUVEC nuclei ...
-
bioRxiv - Bioengineering 2020Quote: ... in 1x PBS and exposed for 1h to a 3% Bovine Serum Albumin (BSA, Sigma Aldrich) blocking solution in 1x PBS.
-
bioRxiv - Biochemistry 2020Quote: ... 2-acetazolamide and 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) were purchased from Millipore-Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... The sequence of the biotinylated 2’-deoxyoligonucleotide is 5’ – (Biotin) AAATGGTGCCGAAACCCGGGATCGAACCAGGGT – 3’ (Sigma Aldrich, Munich, Germany)
-
bioRxiv - Neuroscience 2021Quote: ... washed 3 times for 15 min using 1× PTW and mounted in 87% glycerol (Sigma-Aldrich)/ddH2O containing 25 mg/ml DABCO (Roth/Lactan) ...
-
bioRxiv - Neuroscience 2021Quote: ... Amigo2-icreER;ROSA-TdTomato mice were given 2 or 3 daily intraperitoneal injections of tamoxifen (Sigma T5648 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue sectioned using Leica Microtome at 3 μm thickness were taken to poly-L-Lysine (Sigma) coated slides ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... 3-5 μL of biliverdin hydrochloride (chromophore for iRFP signal activation, final concentration 0.002%, Sigma; 30891) added to cells and incubated for 10 mins at 37 °C before imaging ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pre-cleared protein solution was incubated with 3 μg anti-FLAG antibody (Sigma Aldrich, #F1804) or IgG (Millipore ...
-
bioRxiv - Cell Biology 2021Quote: ... and NaN3 to a final concentration of 0.1 M phosphate and 0.5 mM TMSP ((3-trimethylsilyl)propionic-(2,2,3,3-d4)-acid sodium salt) and 1.5 mM NaN3 (all from Sigma) and transferred to 3 mm NMR tubes (Cortecnet).
-
bioRxiv - Neuroscience 2019Quote: ... Albino tadpoles were anaesthetized in 0,02% MS-222 (ethyl 3-aminobenzoate methanesulfonate; Sigma-Aldrich; pH: 7.6) for 5 min until complete immobility and irresponsiveness ...
-
bioRxiv - Neuroscience 2019Quote: ... embedded with sucrose 30% for 3 days and finally frozen in 2-methylbutane (Sigma-Aldrich, France) at −80°C ...
-
bioRxiv - Microbiology 2020Quote: ... membranes were washed in PBS then blocked in PBS containing 3% bovine serum albumin (Sigma Aldrich). Primary antibodies were applied overnight and bound primary antibodies were detected by probing with species specific HRP conjugate secondary antibodies in 5% skim milk ...
-
bioRxiv - Cell Biology 2021Quote: ... and washed 3 times in 1x PBS and 2 times in 2x SSC buffer (Sigma-Aldrich) for five min each ...
-
bioRxiv - Plant Biology 2020Quote: ... supplemented with 10 g L−1 sucrose and 3 g L−1 phytagel (Sigma, Steinheim, Germany) or 8 g L−1 agar (Winkler ...
-
bioRxiv - Microbiology 2020Quote: ... cell culture medium was replaced with D-MEM containing 10 mM 3-methyladenine (M9281, Sigma Aldrich), 300nM geldanamycin (InvivoGen) ...
-
bioRxiv - Microbiology 2020Quote: ... 1 mg ml-1 of 3–5 kDa fluorescein isothio-cyanate (FITC)-dextran (Sigma-Aldrich, Germany) in phenol-red free DMEM/F12 medium (Sigma-Aldrich ...
-
bioRxiv - Systems Biology 2021Quote: ... and then the entire volume applied to a 3 kDa MWCO spin filter (Amicon Ultra; Millipore) and centrifuged at (3,200 x g held at 4° C ...
-
bioRxiv - Plant Biology 2021Quote: ... Blots were developed using nitroblue tetrazolium and 5-bromo-4-chloro-3-indolyl phosphate (Sigma Argentina).
-
bioRxiv - Neuroscience 2021Quote: ... frozen VMH (from 2 – 3 mice) was homogenized in Lysis Buffer (EZ Prep Nuclei Kit, Sigma) with Protector RNAase Inhibitor (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... 2 mM EDTA and 1 % [v/v] protein phosphatase inhibitor cocktail 2 and 3 (Sigma-Aldrich)) were added at a concentration of 2 mL/g tissue powder ...
-
bioRxiv - Microbiology 2021Quote: ... Supernatant was transferred to Amicon Ultra-0.5 Centrifugal Filter Unit 3 KDa (Merck Millipore cat # UFC500396) and centrifuged for 45 minutes at 4°C at 12,000 g ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-Iodo-L-tyrosine (3IY; stored at −20 °C; CAS: 70-78-0, Sigma, Steinheim, Germany) was added at a concentration of 5 mg/ml to the respective sample ...
-
bioRxiv - Developmental Biology 2021Quote: ... Proteins were immunoprecipitated by the addition of 3 µl of rabbit anti-FGFR3 (Sigma-Aldrich, F0425)/500 µg protein with protein A-agarose (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... concentrated with Amicon Ultra centrifugal filter tubes with a cut-off 3 kDa (Millipore Sigma UFC9003). Proteins were further purified with (HiTrap Q FF ...
-
bioRxiv - Neuroscience 2019Quote: ... Antibodies were diluted in 3% normal donkey serum (monoclonal mouse anti-mouse GFAP 1:2000, Sigma G-A-5 ...
-
bioRxiv - Physiology 2021Quote: ... 2.5 CaCl2 and 10 glucose containing 3 mg/ml collagenase type IV A (Sigma Aldrich, USA), gently bubbled with carbogen (95% O2 ...
-
bioRxiv - Microbiology 2021Quote: 3 µL sample were spotted twice onto a 10×20 cm thin layer chromatography plate (Millipore TLC Silica gel 60 ...
-
bioRxiv - Neuroscience 2020Quote: ... Then washed for 5 min x 3 times and blocked in 1% BSA (A3059, Sigma-Aldrich) (w/v ...
-
bioRxiv - Biophysics 2020Quote: ... followed by 3× washes with PBS (mouse monoclonal anti-α-Tubulin, clone TUB-A4A Sigma Aldrich; mouse monoclonal tyrosine anti--Tubulin ...
-
bioRxiv - Microbiology 2020Quote: ... Secondary antibodies were diluted in 3% BSA/PBS containing 1µg/ml Hoechst 33342 (B2261, Sigma-Aldrich), followed by 2×5min washes in 10mM PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Soft PDMS gels were subsequently treated with (3-aminopropyl)triethoxysilane (APTES, Sigma-Aldrich, cat. no. A3648) diluted at 5% in absolute ethanol ...
-
bioRxiv - Cell Biology 2020Quote: ... larvae and adults were incubated in 3 μM and 2.5 μM 4-hydroxytamoxifen (4-OHT, Sigma), respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... and MC3T3 cells (3 × 104 cells/well) were seeded into Millicell Hanging Cell Culture Inserts (Millipore) in the six-well co-culture plates ...
-
bioRxiv - Bioengineering 2022Quote: ... Sections were washed 3×5 minutes in TBST buffer and incubated with ChAT antibody (Sigma, AB144) at 1:100 dilutions overnight at 4°C in the blocking buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... The cleaned dishes were incubated with 1 mL of 1% (3-aminopropyl) triethoxysilane (APTES; Sigma Aldrich) in ethanol for 1hour at room temperature ...
-
bioRxiv - Physiology 2022Quote: ... Samples were rinsed 3 times in WB and fixed with 10% formalin neutral buffered solution (Sigma), washed and resuspended in WB for processing with a BD LSRII SORP flow cytometer/ DIVA software ...