Labshake search
Citations for Millipore Sigma :
651 - 700 of 10000+ citations for 5 Nitro 1H benzo de isoquinoline 1 3 2H dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... 5’ – CACCGCCGCCTCCGCGCTTCCCCGA – 3’ PIEZO1_sgRNAact_TSS143 (guide 3): 5’ – CACCGAGGCCCCAACGCACCAGGGC – 3’ Modified U251 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; D5796, Sigma), supplemented with 10% foetal bovine serum (FBS ...
-
bioRxiv - Physiology 2022Quote: ... Nω-nitro-L-arginine methyl ester (10mg/kg, 15 min later, Sigma, USA, N5751-5G, purity>98%), and ioversol injection (8.3 mL/kg ...
-
bioRxiv - Developmental Biology 2022Quote: ... Staining was achieved by adding a solution of 4-Nitro blue tetrazolium chloride (NBT, 11383213001, Merck-SIGMA) and 5-Bromo-4-chloro-3-indolyl phosphate disodium salt (BCIP ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-cyano-7-nitroquinoxaline-2,3-dione-disodium salt (CNQX, a non-NMDA receptor blocker), and picrotoxin (PIC, a GABAA receptor blocker) were purchased from Sigma-Aldrich, and L-2-amino-5-phosphonopentanoic acid (APV ...
-
bioRxiv - Neuroscience 2024Quote: ... the glutamatergic nature of EPSCs was confirmed by a complete block of spontaneous activity with 6-cyano-7-nitroquinoxaline-2,3-dione disodium salt (CNQX, 50 μM, Sigma-Aldridge, US) and D-2-amino-5-posphonopentanoic acid (APV ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimidehydrochloride (EDC) were procured from Sigma Aldrich, USA.
-
bioRxiv - Molecular Biology 2023Quote: ... 3-[(3-Cholamidopropyl) dimethylammonio]-1-propanesulfonate hydrate (CHAPS) (C3023; Sigma Aldrich), and sodium dodecyl sulfate (SDS ...
-
bioRxiv - Plant Biology 2022Quote: ... and crosslinked using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (Sigma). Biotin-labelled probes were hybridized with sRNAs on the nylon membrane and stabilized streptavidin-horseradish peroxidase was used to detect the biotin signal.
-
bioRxiv - Synthetic Biology 2023Quote: ... activated with 250mM 1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Sigma)/ N-Hydroxysuccinimide (NHS ...
-
bioRxiv - Biophysics 2024Quote: ... 15 mM 1-[3-(dimethylamino)propyl]-3-ethylcarbodiimide (Millipore Sigma E6383), 5 mM N-hydroxysuccinimide (NHS ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.05% Triton X-100 in PBS) for 1h at room temperature and incubated with anti-NeuN (Millipore #MAB377, RRID:AB_2298772, 1:500-1:1000) and anti-NeuroD (Santa Cruz Biotechnology #sc-1084 ...
-
bioRxiv - Biochemistry 2024Quote: ... Wells were blocked with 200µL 1% BSA prepared in 1X TBS for 1h and then incubated with anti-FLAG M2-HRP (1:10,000) (Sigma-Aldrich, Cat. no: A8592) for another 1h ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 mM 3-isobutyl-1-methylxanthine (IBMX, Sigma), 1 mM DTT (Sigma) ...
-
bioRxiv - Neuroscience 2021Quote: ... 30 μm coronal sections containing the mHb and the IPN were blocked and permeabilized in 5% NDS and 0.3% TX-100 in PBS for 1h and incubated with rabbit anti GluA1 (1:400, AB1504, Millipore) and mouse anti GluA2 (1:400 ...
-
Direct intracellular visualization of Ebola virus-receptor interaction by in situ proximity ligationbioRxiv - Microbiology 2020Quote: ... cleaved viral particles bearing GPCL were first generated by incubation with thermolysin (THL, 1 mg/ml, pH 7.5, 37°C for 1h; Sigma) or recombinant human cathepsin L (CatL ...
-
bioRxiv - Neuroscience 2022Quote: Brain sections were first incubated for 1h at room temperature (RT) in a blocking solution containing 1% BSA (Sigma), 2% Donkey Serum (Biowest ...
-
bioRxiv - Microbiology 2021Quote: ... Antibodies to the N protein was detected by incubation for 1h at 37°C with anti-human IgG peroxidase (1:30,000, Sigma). The plates were washed three times with PBS with 0,05% Tween-20 between each step ...
-
bioRxiv - Cancer Biology 2021Quote: ... Slides were then incubated 1h at RT with the rabbit polyclonal antiTWIST1 (1/50, ABD29, Millipore, Burlington; MA, USA); or 1h at 37°C with the sheep polyclonal anti-TWIST2 (1/200 ...
-
bioRxiv - Biophysics 2023Quote: ... samples were incubated with the following primary antibodies for 1h: mouse anti-α-Tubulin (1:1000, T5168, Sigma-Aldrich) and rabbit anti-Lamin A (1:1000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... sample could be incubated also for 1h with oligo-dT-dig probe (1:1000, polyT-dig Sigma HA09131354-004). Antibodies were diluted 1:500 in blocking buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... Fixed samples were washed rapidly twice with PBS and 3 times for 15 min with PBS-0.3% Triton X-100 (PBT) before being pre-incubated for 1h in PBT-1% bovine serum Albumin (BSA, Sigma). Samples were incubated overnight at 4°C with primary antibody diluted in PBT-1% BSA ...
-
bioRxiv - Plant Biology 2024Quote: ... The membrane was incubated 2h at 4°C with ANTI-FLAG antibodies® M2-peroxydase (Sigma-Aldrich, used at 1/ 1000 dilution). The antibodies were detected by using Lumi-Light Western Blotting Substrate (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were diluted in a 5:1 (5X) stimulation buffer containing 500 µM of 3-isobutyl-1-methylxanthine (IBMX) (Sigma Aldrich, Saint Louis, MO). To an HTRF 96-well low volume white plate (CisBio) ...
-
bioRxiv - Microbiology 2020Quote: ... for 1h and alkylated with 50mM iodoacetamide (#I114, Sigma-Aldrich, USA) for 1h at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2020Quote: ... at 37°C (1h) followed by treatment with 0.05% DNase (Sigma) and 5% FBS ...
-
bioRxiv - Immunology 2020Quote: ... After 1h (or 3h,) 10 μg/ml brefeldin A (Sigma-Aldrich) and 1× monensin (Biolegend ...
-
bioRxiv - Neuroscience 2023Quote: ... first for 1h with a 4% Triton X-100 (Sigma Aldrich) in PBS to permeabilise and a second time for 1h in 0.5% Triton X-100 1% fish gelatin (CAS #9000-70-8 ...
-
bioRxiv - Neuroscience 2023Quote: ... incubated first 1h in PBS containing 0.3% Triton X-100 (Sigma) and then in a blocking solution containing 3% horse or goat normal serum and 1% bovine serum albumin (BSA) ...
-
bioRxiv - Biophysics 2020Quote: ... the following target sequences were used: 5’-GCTTCAGGATTCAATGCCATGG-’3 (#1) using the all-in-one CRISPR/Cas9 plasmid (Sigma-Aldrich) followed by cell-sorting for GFP expression to generate single cell clones with disrupted ANXA4 reading frame.
-
bioRxiv - Cancer Biology 2021Quote: ... the plates were cultured for 2-3 weeks in the incubator at 37°C with 5% CO2 before being stained with 1% crystal violet reagent (Sigma) and counted.
-
bioRxiv - Neuroscience 2020Quote: ... Tg[elavl3:Gal4;10xUAS:jRGECO1b] at 3 dpf were paralyzed by a 5-min bath application of 1 mg/ml a-bungarotoxin (Sigma, 203980). Larvae were mounted on their side in a field stimulation chamber (Warner ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a 0.2 nM αV imager strand buffer solution (5-GGAGGA-3’-Atto643, Eurofins) were made using 1× PCA (Sigma-Aldrich), 1× PCD (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2024Quote: ... homogenized in cytosol lysis buffer (10 mM Hepes, 40 mM KCl, 3 mM MgCl2, 5% glycerol, 0.2% NP40, 1 mM DTT, cOmplete protease inhibitors, Sigma-Aldrich) and incubated for 30 min at 4°C with rotation ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 5 minutes followed by 3 washes in 40mM Tris buffer (pH=7.2) and then 1:20 Giemsa solution (Sigma-Aldrich). The blood and bone marrow were then imaged on a Zeiss Axio Imager.A2 and Zen Blue software (version 3.1).
-
bioRxiv - Bioengineering 2022Quote: ... with a 3:1 M ratio of 5-norbornene-2-carboxylic acid (mixture of endo and exo isomers; Millipore-Sigma) to HA-TBA repeat units ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were then washed (3 × 5 min. in PBS at RT) before staining with DAPI (1:1000; Sigma Aldrich, D9542) and AlexaFluor-488 Phalloidin (1:100 ...
-
bioRxiv - Neuroscience 2023Quote: ... samples were rinsed 5 × 3 min with double distilled water (ddH2O) and subsequently exposed to 1% aqueous thiocarbohydrazide (TCH) (#88535 Sigma) solution for 20 min ...
-
bioRxiv - Cell Biology 2024Quote: ... After the last EtOH wash the coverslips were incubated with methanol containing 5% acetic acid and 1% (3-Aminopropyl)triethoxysilane (Millipore-Sigma) overnight in a vacuum desiccation chamber in the dark ...
-
bioRxiv - Microbiology 2024Quote: ... Each extract was resuspended in 170 µL of 100% methanol containing isotopically labeled internal standards (5-50 µM of 13C,15N Cell Free Amino Acid Mixture, #767964, Sigma; 1 ug/mL 2-amino-3-bromo-5-methylbenzoic acid, ABMBA, #R435902, Sigma) and centrifuge-filtered (0.22 µm hydrophilic PVDF membrane ...
-
bioRxiv - Neuroscience 2024Quote: ... and the samples were washed 3 times for 5 min in PBS and counter-stained with 1:1000 DAPI (D9542, Sigma) for 15 min ...
-
bioRxiv - Microbiology 2024Quote: ... and their lungs were minced with scissors and digested in 3 ml of RPMI-1640 with 5% heat-inactivated FBS containing 1 mg/ml collagenase D (Sigma) and 30 µg/ml DNAseI (Sigma ...
-
bioRxiv - Biochemistry 2024Quote: ... and 1,2-dioleoyl-sn-glycero-3-phospho-(1’-myo-inositol-4’,5’-bisphosphate) (PI(4,5)P2) in chloroform: methanol (Millipore MX0488): water (20:9:1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 4% SDS and 20% de glycerol) supplemented with PMSF (1 mM) and a Protease Inhibitor Cocktail (PIC, Sigma). After vigorous vortexing ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-TRF1 (gift from Titia de Lange) and mouse anti-α-tubulin (1: 5,000) (Sigma-Aldrich #T6199) at 4 °C ...
-
bioRxiv - Plant Biology 2024Quote: ... The tissue was placed in 99.8% ethanol and LR White resin (at a ratio of 3:1, 1:1, 1:3; Sigma Aldrich, USA), and next in 100% resin LR White ...
-
bioRxiv - Bioengineering 2024Quote: At 1 dpf ZF embryos were de-chorionated by treating the eggshell with pronase (1 mg/mL; Sigma, P5147-1G, lot: SLCF6250) for approx ...
-
bioRxiv - Neuroscience 2021Quote: ... Following two 2h washing steps in PTwH (PBS / 0.2% Tween-20 (P9416, Sigma Aldrich) / 0.01mg/ml Heparin ...
-
bioRxiv - Neuroscience 2020Quote: ... Transcription was inhibited by 2h exposure to 8mg/ml of Actinomycin D (Sigma-Aldrich). Histone deacetylases were inhibited by 12h treatment with 200nM Trichotstatin A (Abcam).
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 2h with antibodies recognizing the FLAG-tag (F-1804; Sigma-Aldrich), Strep-tag (NBP2-41073 ...
-
bioRxiv - Microbiology 2021Quote: 5-aza-2’-deoxycytidine (5-AzadC, A3656) and epigallocatechin-3-gallate (EGCG, E4143) were purchased from Sigma Aldrich. Antibodies against CREB (sc-186) ...