Labshake search
Citations for Millipore Sigma :
501 - 550 of 946 citations for Fluorescein alkynylamino atp since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Intestinal permeability assay was performed by evaluation of fluorescein isothiocyanate (FITC)-dextran (Sigma Aldrich) in the blood as previously described 22 ...
-
bioRxiv - Neuroscience 2020Quote: ... Glucose-Udp-Fluorescein conjugate 488 (3% dilution in intracellular solution, SMB00285-100UG, Sigma, Germany), Alexa Fluor 488 goat anti-rabbit IgG and 568 anti-rabbit IgG (3% dilution in intracellular solution ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Intestinal permeability test was performed using fluorescein isothiocyanate conjugated dextran (FITC-dextran) (Sigma-Aldrich, St ...
-
bioRxiv - Immunology 2020Quote: ... and were labeled with 5 mM of carboxy-fluorescein diacetate succinimidyl ester (CFSE) (Sigma) in PBS for 15 min at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... mice were injected with 150μl of 5% w/v fluorescein-dextran (Sigma FD2000S 2MDa). For experiments mice were anesthetized with 2% isoflurane and the hair of the ear was removed using hair removal crème ...
-
bioRxiv - Immunology 2021Quote: ... and an anti-FLAG fluorescein isothiocyanate (FITC) monoclonal antibody (clone M2-FITC, Sigma-Aldrich) was added as a marker for Fab expression ...
-
bioRxiv - Molecular Biology 2021Quote: ... the cells were fed by dichloro-dihydro-fluorescein diacetate (DCFH-DA)(D6883, Sigma-Aldrich) for 60 min in fresh DMEM media ...
-
bioRxiv - Immunology 2020Quote: ... The ApopTag® Plus In Situ Apoptosis Fluorescein Detection Kit (S7111 Sigma-Aldrich, UK) was used following manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... leakage of 1 mg/ml fluorescein isothiocyanate (FITC)-conjugated dextran (70 kDa; Sigma-Aldrich) from the top to the bottom compartment was used to calculate permeability ...
-
bioRxiv - Biochemistry 2023Quote: EMSA was performed with a commercially synthesised 5’ FAM (Fluorescein amidites) modified DNA (Sigma). For this experiment 40bp DNA(65.5%GC ...
-
bioRxiv - Microbiology 2023Quote: ... resuspended in 1x PBS and labeled with 0.1 mg/ml fluorescein isothiocyanate (FITC) (Sigma) at 4°C for 1 h ...
-
bioRxiv - Physiology 2022Quote: ... mice received oral gavage of 3-5 kDa fluorescein isothiocyanate (FITC)–dextran (Sigma-Aldrich) (60 mg/100 g body weight) ...
-
bioRxiv - Physiology 2023Quote: ... we used the ApopTag Fluorescein Direct In Situ Apoptosis Detection Kit (S7160, Millipore Sigma) as previously described [22] ...
-
bioRxiv - Plant Biology 2022Quote: ... TS sections were stained with wheat germ agglutinin-fluorescein isothiocyanate (WGA-FITC, Sigma-Aldrich) (maximum excitation ...
-
bioRxiv - Immunology 2022Quote: ... and then surface-stained with fluorescein isothiocyanate-conjugated anti-mouse CD4 antibody (Millipore, Billerica) for 30 min at 4°C in the dark ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cells were co-stained with 0.5 μg/ml of Fluorescein Diacetate (FDA; Sigma) and 1 μg/ml of Propidium Iodide (PI ...
-
bioRxiv - Cancer Biology 2024Quote: ... either 2% fluorescein isothiocyanate-dextran (FITC-Dex) (average mol wt 250,000) (Sigma-Aldrich, FD250S) in OPTI-MEM ...
-
bioRxiv - Microbiology 2024Quote: ... 50 µg/ml of 3-5 kDa Fluorescein isothiocyanate-dextran (FITC-dextran, Sigma-Aldrich) was added to the apical channel media on the day before Salmonella Typhimurium infection ...
-
bioRxiv - Bioengineering 2024Quote: ... and Fluorescein isothiocyanate–dextran average mol wt 10,000 (FITC-Dextran 10, D10K) (Sigma-Aldrich)] was evaluated by placing a membrane in a side-by-side diffusion set up ...
-
bioRxiv - Immunology 2024Quote: ... mice were gavaged with fluorescein isothiocyanate (FITC)-dextran solution (Sigma-Aldrich, # 46944-500MG-F) at a dose of 44 mg per 100 g of body weight ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.2% NP-40 + 0.1 mM ATP and a protease inhibitor cocktail (SIGMA). Lysate was rotated end-over-end for 1h at 4°C to ensure lysis ...
-
bioRxiv - Neuroscience 2021Quote: ... Local puff application of ES with or without 5 mM ATP (Sigma) was performed using a micropipette with a tip diameter of 1-2 μm introduced via the contralateral optic tectum to the target tectum region ...
-
bioRxiv - Neuroscience 2020Quote: ... ATP (Cat. No. A2383) and all salts were obtained from Sigma-Aldrich.
-
bioRxiv - Biochemistry 2021Quote: ... The protein was applied to column packed with ATP-agarose (Sigma Aldrich) and the column was washed with buffer A (25 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... either in the absence or presence of 2 mM ATP (Sigma-Aldrich) and 2 mM MgCl2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were treated with 100μM ATP (A2383, Sigma-Aldrich, St. Louis, MO), 100μM or 400μM CTP (Cat ...
-
bioRxiv - Immunology 2020Quote: ... and ATP diphosphohydrolase (apyrase - 6 U/mL, 30 μL/mouse - Sigma-Aldrich) were topically applied for 14 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... or a mixture of both CoA and ATP (all from Sigma-Aldrich). NME1 (50 µM ...
-
bioRxiv - Molecular Biology 2024Quote: 10 μM VP 1394 oligonucleotides (ACGATTAACCCTGATACCAA) were phosphorylated with 1mM ATP (Sigma) and 10 units PNK (NEB ...
-
bioRxiv - Cell Biology 2024Quote: ... These were 1.0 μM of the ATP-synthase inhibitor oligomycin (Millipore Sigma), 1.5 μM of the uncoupler carbonyl cyanide 4-(trifluoromethoxy ...
-
bioRxiv - Neuroscience 2023Quote: ... Females were fed sheep blood (Hemostat DSB100) supplemented with ATP (Sigma A6419) at a final concentration of 1 mM using a Glytube membrane feeder (58) ...
-
bioRxiv - Biochemistry 2023Quote: ... and subsequently with Buffer A supplemented with 1 mM ATP (Sigma-Aldrich), 10 mM MgCl2 ...
-
bioRxiv - Microbiology 2024Quote: ... We used pure ATP (adenosine 5’-triphosphate disodium salt hydrate, Sigma Aldrich) to create a standard curve to quantify the concentration of ATP normalized by cell density (OD600)(37) ...
-
bioRxiv - Microbiology 2022Quote: ... for 16 h and 5 mM adenosine triphosphate (ATP, # A26209, Sigma-Aldrich) for the time required for the analysis (1 to 8 hours) ...
-
bioRxiv - Bioengineering 2023Quote: ... A standard calibration curve was generated using ATP disodium salt (Sigma Aldrich) at a concentration range of 10 nM to 1 μM.
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was resuspended with ATP releasing agent from Sigma (FLSAR-1VL). 10 µL of the supernatant was diluted with 90 µL of homogenization buffer and used for further experiments ...
-
bioRxiv - Immunology 2024Quote: ... ATP (Cat# A6419) and Tamoxifen (Cat# T5648) were obtained from Sigma-Aldrich. LPS-Re mutant (Lipid A ...
-
bioRxiv - Cancer Biology 2021Quote: ... 33μM of the β-gal substrate C12FDG (Fluorescein di-β-D-galactopyranose) (F2756 Sigma-Aldrich) was added to the cells for 8h at 37°C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Cell walls were stained with FITC-ConA (fluorescein isothiocyanate-conjugated, concanavalin A, Sigma-Aldrich C7642). Cell nucleus were stained by hoechst-mix (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: TUNEL staining was performed with an ApopTag fluorescein in situ apoptosis detection kit (EMD Millipore) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... Fluorescein isothiocynate human serum albumin (FITC-HSA) was purchased from Sigma Aldrich (Oakville, ON, Canada). Milrinone was purchased from Selleck Chemicals (Burlington ...
-
bioRxiv - Cell Biology 2021Quote: ... F-actin filaments were stained with fluorescein isothiocyanate labeled phalloidin (P5282; Phalloidin-FITC; Sigma-Aldrich). The stained coverslips were mounted on slides with Fluoroshield™ mounting medium containing 4’ ...
-
bioRxiv - Microbiology 2020Quote: For assessing in vivo intestinal permeability fluorescein isothiocyanate (FITC)-labeled dextran assay (4kDa, Sigma Aldrich) was used ...
-
bioRxiv - Cell Biology 2021Quote: Apoptosis was determined with the ApopTag® Fluorescein In Situ Apoptosis Detection Kit (Sigma, S7110) (2017-2019) ...
-
bioRxiv - Immunology 2020Quote: ... or were performed using 5mg/ml Fluorescein Diacetat (FDA; Sigma-Aldrich Co. LLC, C-7521) and 2mg/ml Propridium Iodide (Sigma-Aldrich Co ...
-
bioRxiv - Molecular Biology 2020Quote: ... Chromosome XII was identified by Southern blot using a fluorescein-labelled probe (Sigma-Aldrich, #11585622910) against the NTS1 region within the rDNA [7,26] ...
-
bioRxiv - Neuroscience 2021Quote: ... Fluorescein isothiocyanate (FITC)-conjugated Isolectin B4 from Griffonia simplicifolia (IB4, 10 μg/mL; L2895, Sigma), IB4-AlexaFluor 568 conjugate (2 μg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... Bacteria were resuspended in carbonate buffer and incubated with fluorescein 5(6)-isothiocyanate (FITC, Sigma) dissolved in DMSO (dimethyl sulfoxide ...
-
bioRxiv - Genetics 2020Quote: ... Cell wall was stained by FITC-ConA (fluorescein isothiocyanate-conjugated, concanavalin A, Sigma-Aldrich C7642). Cell nucleus was stained by hochest-mix (Thermo Fisher ...
-
bioRxiv - Biophysics 2021Quote: Proteins and peptides were labelled at their N-terminus with Fluorescein 5-Isothiocyanate (FITC, Sigma), purified and quantified following a described protocol [45] ...