Labshake search
Citations for Millipore Sigma :
5401 - 5450 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: Female 7-12-week-old FVB/NJ mice were superovulated by intraperitoneal injection of 5 IU pregnant mare serum gonadotropin (PSMG) (ProSpec HOR-272) followed by 5 IU human chorionic gonadotropin (hCG) (Sigma CG10) 48 hours later.
-
bioRxiv - Genomics 2021Quote: ... The tissue was mechanically lysed with a scalpel in a total volume of 5 ml lysis buffer (0.32 M sucrose [Sigma-Aldrich 84097], 5 mM calcium dichloride [Sigma-Aldrich 21115] ...
-
bioRxiv - Biochemistry 2020Quote: ... HLCs were exposed to either 5-Aminoimidazole-4-carboxamide-1-β-D-ribofuranosyl 5′-monophosphate (AICAR; 1mM; Sigma-Aldrich, A1393-50MG), O-(Carboxymethyl)hydroxylamine hemihydrochloride (AOA ...
-
bioRxiv - Neuroscience 2020Quote: ... retinas were washed during 5 minutes in PBS and permeabilized overnight at 4°C in 5% normal goat serum (NGS, Sigma Aldrich) and 1% Triton-X100 in PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... 45 μL of this solution was removed and added to either 5 μL of low TE or 5 μL of 10% Triton-X (X100-500ML, Sigma Aldrich). These two specimens constitute the undiluted eluate from the dry swabs.
-
bioRxiv - Neuroscience 2020Quote: ... which were then plated in black 96-well plates in the presence of 5 mM complex I substrates glutamate and malate with or without 5 µM CCCP (carbonyl cyanide m-chlorophenyl hydrazone, Sigma-Aldrich) and 1 µM TMRM (tetramethylrhodamine ...
-
bioRxiv - Microbiology 2021Quote: ... the membranes were transferred to sterile containers and washed with 5 ml of TSB supplemented with 5 µg/ml of rifampicin (Sigma-Aldrich). Next ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl cells were spread on a 1 mm glass slide pre-treated with 5 μl poly-L-lysine (Sigma Aldrich). A Nikon 9Oi eclipse microscope was used to capture differential interference contrast (DIC ...
-
bioRxiv - Immunology 2020Quote: ... Red blood cells were then lysed by incubating for 5 minutes at room temperature in 5 ml of lysis buffer [0.864% ammonium chloride (Sigma-Aldrich: A0171) diluted in sterile de-ionized H2O)] ...
-
bioRxiv - Neuroscience 2020Quote: Human cofilin1 was amplified by PCR using specific oligonucleotides (forward: 5’-CATATGGCCTCCGGTGTG-3’, reverse: 5’-GGATCCTCACAAAGGCTTGCCCTC-3’) and cloned into the pET-15b vector (Novagen, Millipore, UK). By using site-directed mutagenesis ...
-
bioRxiv - Microbiology 2021Quote: ... gondii parasites were cultured in complete medium (DMEM, +5 % FCS) or in custom culture medium −Pan (DMEM −Pan, +5 % dialyzed FBS) supplemented with Val (Sigma, V6504), pantoate (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... The nuclei were re-suspended in 5 ml washing buffer (0.32 M sucrose [Sigma-Aldrich 84097], 5 mM calcium dichloride [Sigma-Aldrich 21115] ...
-
bioRxiv - Biophysics 2020Quote: ... 5 μl washed beads were added with 5 μl of 0.5 mg/ml lectin (lectin from Phaseolus vulgaris, Sigma L2646-25MG) and incubated at 4 °C for 1 hour ...
-
bioRxiv - Bioengineering 2022Quote: ... were digested overnight in papain digestion buffer (containing 100 mmol phosphate buffer, 5 mmol L-cystein, 5 mmol EDTA and 140 μg/ml papain (P4762, Sigma-Aldrich)) at 60 °C ...
-
bioRxiv - Bioengineering 2022Quote: Films (N = 5 per condition) were lyophilized and incubated for 48 h in 5 wt% trichloroacetic acid (TCA, T6399, Sigma-Aldrich). Scaffolds (N = 5 per condition ...
-
bioRxiv - Bioengineering 2022Quote: ... The cells were then incubated in a blocking buffer (5% normal goat serum, Vector; 5% normal donkey serum, Wako; 3% BSA, Sigma-Aldrich; and 0.1% Tween-20 ...
-
bioRxiv - Molecular Biology 2020Quote: ... LdBob promastigotes were routinely maintained at 26 °C in 5% CO2 and cultured in Dulbecco’s Modified Eagle-Leishmania (DME-L) medium supplemented with 5% SerumPlus™ (SAFC BioSciences/Sigma Aldrich, St ...
-
bioRxiv - Microbiology 2020Quote: ... serial 10-fold dilutions of conidia ranging from 105 to 102 cells in a volume of 5 μl were spotted onto AMM agar plates supplemented with 5 mM protamine (Sigma-Aldrich), 0.01% SDS (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... was performed using a pre-annealed DNA-RNA template (DNA45: 5’-TTCTTT ATCTCTTATTTCCTTCTATTTTCCACGCGCCTTCTATTT-3’; RNA13: 5’-[6FAM]-GGCGCGUGGAAAA-3’, Sigma Aldrich). The reaction buffer comprised 25 mM HEPES pH 7.2 ...
-
bioRxiv - Biochemistry 2020Quote: ... myoblasts were transfected at 60% confluency with DNA constructs expressing CMV-Cas9(D10A) and paired U6-gRNAs (5’-GTTGTTGCTGTCTTTCCCCAGG and 5’- ACCCCCGCTTCAACGCCCATGG) (Sigma Aldrich) using TransIT-X2 reagent (Mirus Bio) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Unbound protein was washed off in PBST (3x 5 min) and bound protein was detected using HRP-conjugated anti-His antibody (1:2000 in 5% milk PBST; Novagen #71841). After 1 hour incubation at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... for 2 days with daily change and 5% ammonium solution (diluted with H2O to a final concentration of 5% v/v, 105432, Sigma-Aldrich) for 6h to decolorize ...
-
bioRxiv - Developmental Biology 2021Quote: ... The sections were subsequently dehydrated 2x 5 min in 99% EtOH and 2x 5 min in Xylene prior to coverslip mounting using DPX (Sigma-Aldrich). All images were acquired on an Axio Scan.Z1 (Zeiss ...
-
bioRxiv - Neuroscience 2022Quote: ... diluted 1:20 in paraffin oil (CAS: 042-47-5, AppliChem) and 1-octanol (OCT, undiluted; CAS: 111-87-5, Sigma Aldrich) were used ...
-
bioRxiv - Neuroscience 2023Quote: Medium was exchanged with a 5:1 mixture of pre-warmed culture medium and 5 mg/ml MTT (Sigma-Aldrich, M5655) in PBS for a total volume of 120 µl ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were blocked for 1 hour at room temperature in 5% (w/v) non-fat milk (Marvel) or 5% (w/v) BSA (Sigma-Aldrich) depending on the antibody specifications ...
-
Engineering TALE-linked deaminases to facilitate precision adenine base editing in mitochondrial DNAbioRxiv - Molecular Biology 2023Quote: ... were superovulated by injecting them with pregnant mare serum gonadotropin (5 IU, Prospec) and human chorionic gonadotropin hormone (5 IU, Sigma-Aldrich) intraperitoneally at 48-h intervals ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated for 10 min at room temperature or directly washed by centrifugation at 5,000×g for 5 min and resuspension in 5 µl of 1×PBS supplemented with 0.2 µg/ml propidium iodide (PI) (Sigma-Aldrich P4170). Cells were placed on a 1% agarose pad that was supplemented with either 0.2% arabinose or both 0.2% arabinose and 0.1 mM IPTG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 53 from the RNAi Consortium (clones TRCN0000087290 and TRCN0000087292 with target sequence 5’-GCGGGAGTATAGTGAGTTTAA-3’ and 5’-CGGACAGTTTGGCACAATCAA-3’, respectively, distributed by Sigma-Aldrich, Merck ...
-
bioRxiv - Microbiology 2022Quote: ... AT depots were cut into ≈ 20 mg explants and incubated for 2 hours at 37°C in 96-well plates containing 200 μL low glucose DMEM with 5% (w/v) fatty acid-free BSA and 5 μM of Triacsin C (Sigma, T4540) per well ...
-
bioRxiv - Bioengineering 2022Quote: ... dry weights of scaffolds were collected and samples were digested overnight in papain digestion buffer (containing 100 mmol phosphate buffer, 5 mmol L-cystein, 5 mmol EDTA and 140 µg/ml papain (P4762, Sigma-Aldrich)) at 60 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Negative selection was therefore carried out by culturing the parasites in the presence of 5-fluorocytosine (5-FC, Sigma-Aldrich, UK) at 48 mM and 2.5 nM WR99210 for a week ...
-
bioRxiv - Cell Biology 2024Quote: ... blots were blocked 1 h at room temperature (RT) with 5% non-fat dry milk (Carl Roth, T145.2) or 5% bovine serum albumin (BSA, Sigma-Aldrich, A7906) in TBS-Tween (0.5 M Tris ...
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked for one hour at room temperature in 5% dry milk (Sysco, 5398953) dissolved in TBST (500 mM Tris, 1.5 M NaCl, 0.1% Tween20 [Sigma, 9005-64-5]) followed by overnight incubation with primary antibodies at 4°C ...
-
bioRxiv - Physiology 2023Quote: ... The percentage of apoptotic cells was determined using the DNA-binding dyes propidium iodide (PI, 5 μg/ml) and Hoechst 33342 (HO, 5 μg/ml, Sigma-Aldrich) as previously described ...
-
bioRxiv - Physiology 2023Quote: ... and endothelium-dependent and -independent vasorelaxation responses were determined with acetylcholine (10-9 to 10-5 mol/L) and sodium nitroprusside (10-9 to 10-5 mol/L) respectively (Sigma-Aldrich).
-
bioRxiv - Microbiology 2023Quote: ... The relative msfGFP measurements were normalised for their respective OD600 values and subsequently converted to absolute units of the calibrant 5(6)-carboxyfluorescein (5(6)-FAM)) (Sigma-Aldrich). Finally ...
-
bioRxiv - Immunology 2023Quote: ... and maintained at 37°C with 5% CO2 in complete RPMI in the presence of 5% human AB serum (Sigma-Aldrich) for differentiation into MDMs for 10-14 day (Pierini et al. ...
-
bioRxiv - Immunology 2023Quote: ... cells were fixed for 10 minutes with PFA 5% and permeabilised for 5 minutes with 0.1% saponin in PBS (Sigma Aldrich, USA) and then blocked with PBS-FBS 2% before the staining ...
-
bioRxiv - Molecular Biology 2023Quote: ... permeabilized with 0.25%Triton X-100/PBS for 15 min and blocked for 1 h at RT with 5% NGS (Jackson Immuno Research, 005-000-121) + 5% BSA (Sigma, A2153). The following primary antibodies were used ...
-
bioRxiv - Microbiology 2022Quote: ... the msfGFP levels were normalized for OD600 and converted to absolute units using 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) as a calibrant (36 ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were dissociated using accutase (37 °C, 5 min), centrifuged (300 g, 5 min) and resuspended in activator (containing collagen IV (Sigma-Aldrich), Laminin 521 (BioLamina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples were split in two and either 5 µL buffer or 5 µL 1 µg/µL Proteinase K (Millipore Sigma 3115887001) was added ...
-
bioRxiv - Cell Biology 2022Quote: ... Membranes were incubated overnight at 4°C with primary antibodies diluted either in 5% non-fat dry milk in TBST or 5% Bovine Serum Albumin (BSA, Sigma, # A7906) + 0.02% sodium azide in TBST ...
-
bioRxiv - Bioengineering 2022Quote: ... were weighted and digested overnight in papain digestion buffer (containing 100 mmol phosphate buffer, 5 mmol L-cystein, 5 mmol EDTA and 140 μg/ml papain (P4762, Sigma-Aldrich)) at 60 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were blocked using 5% nonfat milk for 30 minutes and incubated overnight in 5% milk with the following antibodies: PHGDH (1:1000, Sigma HPA021241), GAPDH (1:5000 ...
-
bioRxiv - Microbiology 2022Quote: ... and suspended at 2 x 104 cells/mL in Titan Cell Medium (TCM) composed by 5% Sabouraud, 5% inactivated Fetal Calf Serum (FCS, Biological Industries) and 15 µM sodium azide (Sigma Aldrich), diluted in 50 mM MOPS adjusted to pH 7.3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Slides were then washed 5-6x for 5 min with water and then rinsed in 1% Phosphomolybdic acid (Sigma-Aldrich, HT153) for 10 min and rinsed in water for 5 min ...
-
bioRxiv - Biochemistry 2022Quote: ... Pellets were resuspended in lysis buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 5 mM MgSO4, 5 mM 6-aminocaproic acid (Sigma, cat. #A2504), 5 mM benzamidine (Sigma ...
-
bioRxiv - Immunology 2022Quote: ... Ultrathin sections of 50 nm were blocked with 5% FBS/5% NGS for 30 minutes and subsequently incubated with mouse anti-FLAG (Sigma F3165) for 1 hour at room temperature ...