Labshake search
Citations for Millipore Sigma :
5351 - 5400 of 10000+ citations for 5 Benzyloxy pyrimidine 2 carbonitrile since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Membranes were blocked with 5% BSA (Sigma-Aldrich) in Tris-buffered saline (TBS)-Tween (20 mM Tris-HCl pH7.5 ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were then blocked in 5% BSA (Sigma) in PHEM buffer for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ng/mL human BDNF (Millipore Sigma # SRP3014), 10 µM Rho Kinase Inhibitor (Y-27632 ...
-
bioRxiv - Neuroscience 2024Quote: ... slices were perfused with 5 μM DA (Sigma). The total recording time for each cell was 40 min and the last 10 min of the recording were assessed (D2 MSNs ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg ml−1 insulin (I6634; Sigma-Aldrich) and 10 mM HEPES ...
-
bioRxiv - Biophysics 2024Quote: ... and 5 IU human chorionic gonadotropin (hCG; Millipore) 48 h later ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 µM FTY720 (Sigma-Aldrich, SML0700-5MG). The appropriate media was then added to each flask series ...
-
bioRxiv - Microbiology 2024Quote: ... hemin (5 mg/L) (Sigma-Aldrich, Diegem, Belgium), and 5% sterile defibrinated horse blood (Oxoid ...
-
bioRxiv - Microbiology 2024Quote: ... hemin (5 mg/L) (Sigma-Aldrich, Diegem, Belgium), and menadione (1 mg/L ...
-
bioRxiv - Neuroscience 2024Quote: ... we used 5% Normal Goat Serum (Sigma, NS02L), with 10% BSA + 0.2% Triton ...
-
bioRxiv - Plant Biology 2024Quote: ... 5 µg of 15:0 internal standard (SIGMA) was added to each sample for absolute quantification ...
-
bioRxiv - Neuroscience 2024Quote: ... and blocked with 5% donkey serum (Sigma, D9663) for 2 hours at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 μM 5-hydroxytryptamine creatinine sulfate (Sigma-Aldrich) was washed on for 2 min for recording in 5-HT ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 mM HEPES-hemisodium salt (Sigma, H7637). Surgery was performed as previously described14,15,33 to expose the brain for optical imaging ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 mg/mL insulin (catalog #I0516, Sigma-Aldrich), and 1% penicillin–streptomycin ...
-
bioRxiv - Biophysics 2024Quote: ... 5 mM N-hydroxysuccinimide (NHS) (Millipore Sigma 130672), and a 10x excess of mPEG-NH2 ...
-
bioRxiv - Genomics 2024Quote: ... 1% Triton X-100 (Sigma, 9036-19-5) and 1X protease inhibitor cocktail (Thermo Fisher ...
-
bioRxiv - Neuroscience 2024Quote: ... 5% (v/v) Triton X-100 (Sigma, #T8787), 0.5% (w/v ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 mg/mL D-glucose (Sigma, #G7528-1KG), 0.2 mg/mL L-cystein (MP ...
-
bioRxiv - Biochemistry 2024Quote: ... and 5 mM carbamoyl aspartate (Ca-Asp; Sigma). Protein concentrations were 0.25 μM for the WT and were increased to 2.5-3 μM for the mutants ...
-
bioRxiv - Biochemistry 2024Quote: ... Samples were reduced with 5 mM DTT (Sigma) for 1 h at room temperature and alkylated with 20 mM iodoacetamide (Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... 5 g of PEG 35K (94646; Sigma-Aldrich) was mixed with 1 ml of 1 M KCl (A11662.0B ...
-
bioRxiv - Cancer Biology 2024Quote: ... Primary antibody (anti-laminin-alpha-5 [4C7, Millipore]) diluted 1:500 in the blocking buffer was incubated overnight at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5-(N-ethyl-N-isopropyl)-amiloride (EIPA, Sigma), an inhibitor of Na+/H+ exchange ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% normal donkey serum (Sigma Aldrich, S30-M), and 0.8% Triton X-100 (Sigma Aldrich ...
-
bioRxiv - Biophysics 2024Quote: ... supplemented with 5 units/mL of Benzonase (Millipore)) by plunging on ice in a glass Dounce tissue grinder with a large clearance pestle ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 5 µL 60 mM DTT (Sigma-Aldrich). Samples were sonicated for 5 minutes in an ultrasonic bath ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μM CHIR99021 (Sigma-Aldrich, SML1046 in DMSO), 250 nM torin2 (LC Laboratories ...
-
bioRxiv - Cancer Biology 2024Quote: ... membranes were blocked in 5% BSA (Sigma, A3733) and incubated overnight at 4°C with primary antibodies ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/mL of human insulin (#I9278, Sigma), 100 µM nonessential amino acids (#11140050 ...
-
bioRxiv - Biochemistry 2024Quote: ... An annealed primer (5’-CGCGUAGCAUGCUACGUCAUUCUCCUAAGAAGCUG-3’) (Millipore Sigma) and template (5’-CUAUCCCCAUGUGAGCGGCUCAGCUUCUUAGGAGAAUGACGUAGCAUGCUACG CG-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by injection with 5 U hCG (Sigma) 48 hours later ...
-
Malaria parasite HOPS/CORVET complexes are critical for endocytosis and invasion organelles functionbioRxiv - Cell Biology 2024Quote: ... and 5 µg/mL SYBR Green (Sigma-Aldrich) for 20 min at 37°C and measured with an ACEA NovoCyte flow cytometer by counting 100 000 events ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 5 mM D-glucose-13C6 (Millipore Sigma) for the final 2 hours of treatment then scraped or centrifuged and resuspended into 10% trichloroacetic acid ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5% BSA (Bovine Serum Albumin) (Sigma Aldrich) dissolved in PBS was applied for 1 hour ...
-
bioRxiv - Cancer Biology 2024Quote: ... + 5% Normal Goat Serum (Sigma Aldrich, S26-M) + 2.5% Bovine Serum Albumin (Fisher Scientific BP1600-100 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 µg/ml bovine insulin (Sigma-Aldrich, I6634), and 5 µg/ml N-acetyl-L-cysteine (Cayman Chemical ...
-
bioRxiv - Cancer Biology 2024Quote: ... IgG ChIP-seq (12–371, Millipore, 5 μg) was performed as non-specific binding control ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5% horse serum (Sigma-Aldrich, #H1138) and 1× penicillin/streptomycin (Pen/Strep) ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg ml−1 insulin (I6634; Sigma-Aldrich) and 10 mM HEPES ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 5% fetal bovine serum (FBS; Sigma SH30396.03) and 1% penicillin and streptomycin (Thermo Fisher 15070063) ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 ug/mL DNAse I(Sigma, 10104159001)) ...
-
bioRxiv - Cell Biology 2024Quote: ... estradiol (5 mM stock, Sigma E2758 in ethanol) was added for a final concentration of 1 μM to both subcultures to induce NDT80-IN.
-
bioRxiv - Developmental Biology 2024Quote: ... and 5% normal donkey serum (Sigma-Aldrich, D9663) in PBST ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µM Y-27632 (Sigma-Aldrich, Y0503-1MG), and 2.5 µM prostaglandin E2 (PGE2 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5% normal donkey serum (Sigma Aldrich, S30-M), and 0.4% Triton X-100 (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 5 µM milrinone (Sigma, cat# 475840) to prevent meiotic resumption ...
-
bioRxiv - Molecular Biology 2020Quote: ... The pellets were resuspended at an OD600 of 1 in 5 ml of agroinfiltration buffer (10 mM MgCl2 and 250 μM of 3’,5’-Dimethoxy-4’-hydroxyacetophenone (Sigma-Aldrich)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked for a minimum of 1 hour at room temperature in 5% (w/v) non-fat milk or 5% (w/v) BSA (A4503-50G; Sigma Aldrich) in TBS-T (1x TBS and 0.1% Tween-20 ...
-
bioRxiv - Immunology 2020Quote: ... nitrocellulose membranes were probed with protein-specific primary antibodies diluted in PBS containing 5% Milk or 5% BSA as follows: anti-actin Cat #A5441 from Sigma Aldrich; anti-tubulin Cat #5286 from Santa Cruz ...