Labshake search
Citations for Millipore Sigma :
5351 - 5400 of 10000+ citations since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 mM d-Desthiobiotin (Sigma-Aldrich)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 0.1 mg/ml DNase (Sigma, Cat# DN25) for 1-1.5 hours at 37 ℃ with rotation ...
-
bioRxiv - Molecular Biology 2024Quote: ... containing 0.25% collagenase (Sigma, Cat# C9091), 0.01 M HEPES (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 24h post-treatment cells were washed using room temperature PBS 1X and transferred to an Attofluor Cell Chamber (Sigma Aldrich, A7816), 5 μM of DHE was added in HBBS medium (Hanks’ Balanced Salt Solution ...
-
bioRxiv - Cell Biology 2024Quote: ... for 5 min or 20 µg/mL anti-β-tubulin antibodies (in PBS, #T7816, Sigma) for 5 min ...
-
bioRxiv - Cell Biology 2024Quote: ... 1x protease inhibitors (#04693159001, Sigma) and 0.05% Triton X-100 (# X100 ...
-
bioRxiv - Cell Biology 2024Quote: ... chambers were assembled by melting thin strips of parafilm in between two glass coverslips silanized with 0.05% dichlorodimethylsilane (DDS, #440272, Sigma). The chambers were incubated with 20 µg/mL anti-biotin antibodies (in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... were diluted into BRB80T (BRB80: 80mM PIPES pH 6.9, 1mM EGTA, 1mM MgCl2, supplemented with 10 µM paclitaxel (#17191, Sigma)) ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by 1% Pluronic (F127 in PBS, #P2443, Sigma) for at least 30 min ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell pellets were resuspended in 0.5 pellet volumes of lysis buffer (BRB80 supplemented with 1x phosphatase inhibitors (#4906845001, Sigma), 1x protease inhibitors (#04693159001 ...
-
bioRxiv - Cell Biology 2024Quote: ... The chambers were incubated with 20 µg/mL anti-biotin antibodies (in PBS, #B3640, Sigma) for 5 min or 20 µg/mL anti-β-tubulin antibodies (in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.05% Triton X-100 (# X100, Sigma)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were harvested by trypsinization (Trypsin-EDTA, Sigma-Aldrich), washed three times in PBS and resuspended in 10% glycerol PBS before snap freezing in liquid nitrogen and storage at -80 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 10600002) or 0.2 µm or 0.45 µm PVDF membranes (Amersham Protron, 10600021 or Immobilon-P, Millipore, IPVH00010) for 1 h at 100 V in tris-glycine buffer with 10 % methanol ...
-
bioRxiv - Developmental Biology 2024Quote: ... rabbit anti-Mns1 (Sigma-Aldrich Prestige Antibodies, HPA039975). Antibodies used in the zebrafish study are rabbit anti-HA (Santa Cruz ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-acetylated-tubulin (Sigma, T6793), mouse anti-γ-tubulin (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-γ-tubulin (Sigma, T6557), anti-mouse HRP conjugate (Promega ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-γ-Tubulin (Sigma, T5326), rabbit anti-Mns1 (Sigma-Aldrich Prestige Antibodies ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse anti-acetylated Tubulin (Sigma, T6793), mouse anti-γ-Tubulin (Sigma ...
-
bioRxiv - Developmental Biology 2024Quote: ... 10 mM nicotinamide (Sigma-Aldrich; N0636), 10 ng/ml human hepatocyte growth factor (in-house production) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 0.1 µM dexamethasone (Sigma-Aldrich; D1756), 10 mM nicotinamide (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... supplemented with 10 µg/ml DNase I (Sigma-Aldrich; DN25). Erythrocytes were lysed in red blood cell lysis buffer ...
-
bioRxiv - Developmental Biology 2024Quote: ... primary antibodies against α-tubulin at 1:5000 dilution (mouse, Sigma-Aldrich) and ubiquitin at 1:2000 dilution (mouse ...
-
bioRxiv - Developmental Biology 2024Quote: ... and ubiquitinylated proteins (clone FK2, mouse, Sigma-Aldrich) at 1:200 dilution were added ...
-
bioRxiv - Developmental Biology 2024Quote: ... of NSC668394 (EMD Millipore; Oakville ...
-
bioRxiv - Developmental Biology 2024Quote: Germline nuclei isolation was performed by following a published protocol (70) except that worms were lightly fixed in 50 mL of −20°C dimethylformamide (Sigma-Aldrich) for 2 min and washed three times in PBS before homogenization ...
-
bioRxiv - Developmental Biology 2024Quote: ... the broad-spectrum hydroxamate metalloproteinases inhibitor CT1746 (100 µM) and the protease inhibitor cocktail (a mixture of aprotinin, bestatin, E-64, leupeptin and pepstatin A, 1/1000)(SIGMA, P1860) with or without 20 nM Wnt5a in the presence or absence of 500 nM RAP for 3 h at 37 °C ...
-
bioRxiv - Developmental Biology 2024Quote: ... Dechorionated embryos or larvae were embedded in 1.5% low-melting agarose (ISC BioExpress) containing 0.01% tricaine (Sigma-Aldrich) within glass-bottom Petri dishes (MatTek Corporation) ...
-
bioRxiv - Molecular Biology 2024Quote: Antibodies used for immunoblotting in this study include rabbit polyclonal anti-GFP (ab290, Abcam, 1:2,500 or Sigma, G1544, 1:1000), mouse monoclonal anti-GFP (JL8 ...
-
bioRxiv - Developmental Biology 2024Quote: ... mouse monoclonal anti-FLAG HRP-conjugated (Sigma), and polyclonal anti-XND-1 (Wagner et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1 mM DTT) using Amicon Ultra-15 3 K or 30 K centrifugation units (Merck Millipore). The phase separation assay was performed in the presence or absence of 10% polyethylene glycol 8000 (PEG-8000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5-ethynyldeoxyuridine (EdU, Sigma-Aldrich or Click Chemistry Tools) was at 10mM in DMSO ...
-
bioRxiv - Molecular Biology 2024Quote: ... Macrophages were characterized by cytospin and flow cytometry under basal conditions and following LPS (Sigma-Aldrich St. Louis, MO) stimulation (100 ng/nL for 72 hours ...
-
bioRxiv - Molecular Biology 2024Quote: ... We examined HIO under basal conditions and after 72-hour co-culture with 50,000 LPS (Sigma-Aldrich St. Louis, MO) primed (100 ng/mL ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... The day after seeding cells were treated with MBCD (Sigma C4555) at a concentration of 2.5 mM to deplete cells of endogenous cholesterol ...
-
bioRxiv - Developmental Biology 2024Quote: ... HEK293T culture media was collected at both 48 and 72 hours post transfection and concentrated using Amicon Ultra-15 columns (Millipore; UFC903024). ESCs were first transduced with lentiviral packaged pLX_311 and selected with Blasticidin (Gibco ...
-
bioRxiv - Developmental Biology 2024Quote: ... and phosphatase inhibitors (Sigma; 4906845001). The samples were centrifuged at 13,000rpm (∼15,000G) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and CD68 antibody (Sigma-Aldrich St. Louis, MO), co-stained with DAPI (Thermo Fisher Scientific Waltham ...
-
An endothelial SOX18-mevalonate pathway axis enables repurposing of statins for infantile hemangiomabioRxiv - Molecular Biology 2024Quote: ... transferred to nitrocellulose or to polyvinylidene difluoride (PDVF) and probed with anti-SREBP2 clone 22D5 (Millipore Sigma, MAB1988) followed by anti-GAPDH (Cell Signaling Technology ...
-
bioRxiv - Molecular Biology 2024Quote: ... to generate cDNA and performed qPCR using FastStart Universal SYBR Green Master (Sigma Aldrich). We used primers against Citrine (CGGCGACGTAAACGGCCACAAGTTCAG ...
-
bioRxiv - Developmental Biology 2024Quote: ... then embedded in glass capillary tubes with paired pistons (Sigma Z328510 paired with BR701938 ...
-
bioRxiv - Developmental Biology 2024Quote: ... and Retinoic Acid (100 nM RA; Sigma #R2625) to the N2B27 differentiation medium from day 4 to day 9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 103 units/ml ESGRO leukemia inhibitor factor (LIF) (EMD Millipore). N2a cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM ...
-
bioRxiv - Molecular Biology 2024Quote: ... cells dissociated using Accutase (Millipore) and plated at a density of 30,000/cm2.
-
bioRxiv - Cell Biology 2024Quote: ... The conditioned media was collected and filtered 48h post transfection and used to infect the Kdm4a-null MEFs using polybrene (Millipore Sigma, Cat. # T1003-G) at 10 µg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-γ-tubulin (1:4000, Sigma Aldrich, Cat. # T5326), anti-α-tubulin (1:4000 ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-α-tubulin (1:4000, Sigma Aldrich, Cat. # T6199), anti-α-tubulin (1:1000 ...
-
bioRxiv - Cell Biology 2024Quote: Antibodies were procured from the following sources: anti-KDM4A (1:1000, Sigma Aldrich, Cat. # HPA007610), anti-γ-tubulin (1:4000 ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-SETD2 (1:1000, Sigma Aldrich Cat. # HPA-042451-100), anti-H3K36me3 (1:1000 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and electroblotted onto an Immobilon-P membrane (Merck Millipore) using a semidry transfer apparatus ...