Labshake search
Citations for Addgene :
401 - 450 of 1322 citations for rno mir 22 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... each cell line was given fresh growth medium and transfected with a plasmid mixture containing 1μg PB-rtTA (Addgene #126034; 22) and 1μg pUC19-piggyBac transposase 23 using Lipofectamine 3000 (Thermo Fisher L3000001) ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells expressing doxycycline (DOX)-activated DHFR-UBA5 were cotransfected with two plasmids: (1) pX330-U6-Chimeric BB-CBh-hSpCas9 (Addgene plasmid #42230, a gift from Feng Zhang), for expression of human codon-optimized SpCas9 and sgRNA UBA5 (ACCTACTATTGCTACGGCAA) ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Bioengineering 2021Quote: ... the prime editor expression plasmid [SpCas9(H840A)-RT (Addgene no. 132775), FnCas9(H969A)-RT (developed in this study)] ...
-
bioRxiv - Molecular Biology 2023Quote: ... Plasmids encoding RT proteins used in OTTR are available from AddGene: 2Bc-T MBP_BoMoC(ed)_6xH (JumpPol ...
-
bioRxiv - Biochemistry 2023Quote: ... The pCMV-PE2 plasmid expressing PE2 Cas9-RT fusion protein (Addgene plasmid #132775 ...
-
bioRxiv - Neuroscience 2021Quote: ... a gfp PCR product was PCR amplified from pPD95.75 (Addgene) using primers containing 35bp of overlap with the spop-1 gene immediately upstream of the predicted nuclear localization sequence ...
-
bioRxiv - Microbiology 2021Quote: ... PCR products were then cloned into the pPD95.77 vector (Fire Lab C. elegans vector kit; Addgene, Cambridge, MA) via the SalI and BamHI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml, Addgene) for neuronal Ca2+ detection was mixed with the astrocyte-targeted CalEx encoding construct AAV2/5.GfaABC1D-HA-hPMCA2w/b (1.18 × 1013 gc/ml ...
-
bioRxiv - Genomics 2019Quote: ... pcDNA-dCas9-p300 Core-D1399Y) and guide RNA only expression vector (phU6-gRNA) were gifts from Charles Gersbach(22)(Addgene #61357, #61358 and #53188 respectively). DER-specific gRNAs were designed by submitting DER coordinates or sequence to the CRISPOR (http://crispor.tefor.net ...
-
bioRxiv - Microbiology 2019Quote: ... pCR-BluntII-TOPO (Addgene #41824) (29) ...
-
bioRxiv - Biochemistry 2022Quote: ... The HTT expression constructs were assembled using the BD In-Fusion PCR cloning kit in the mammalian/insect cell vector pBMDEL (Addgene plasmid #111751), an unencumbered vector created for open distribution of these reagents.
-
bioRxiv - Immunology 2022Quote: ... PCR amplified HGS or VPS37A from U937 cDNA and PCR amplified mScarlet from pmScarlet_C1 (Addgene #85042) into pTRIP-SFFV-EGFP-NLS (Addgene #86677) ...
-
bioRxiv - Molecular Biology 2022Quote: PCR fragment with pY010 (Addgene #69982) as template and the following primers was cloned into pX458 (Addgene # 48138 ...
-
bioRxiv - Genetics 2022Quote: ... which we PCR amplified from Addgene plasmid #67639 ...
-
bioRxiv - Genetics 2022Quote: ... we PCR amplified NatMX from Addgene plasmid #35121 with the primers listed in Supplementary Table 6 using Phusion Hot Start Flex DNA polymerase (NEB) ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCR-24xPP7SL (Addgene, Cat.No. 31864) plasmids were double digested using SpeI and NotI restriction enzymes and the 24xMS2SL (1352bp ...
-
2P-NucTag: on-demand phototagging for molecular analysis of functionally identified cortical neuronsbioRxiv - Neuroscience 2024Quote: ... GCaMP7f was PCR-amplified from Addgene plasmid #104492 with a 3’ Primer that contained sequences encoding four Alanine residues and the 2PA sequence (both in frame with the coding sequence of GCaMP7f) ...
-
bioRxiv - Biophysics 2024Quote: ... emiRFP670 were PCR amplified from Addgene Plasmid #136571 (Matlashov et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected a second time with 2μg pCBASceI plasmid (Addgene #26477) using PEI (Polysciences) ...
-
bioRxiv - Cell Biology 2020Quote: ... the Cas9 and mCherry for detection of electroporated cells were obtained from Addgene (plasmids #66939, #66940, #66941). All targeting constructs (for both HDR and NHEJ ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Immunology 2023Quote: ... The wzm – wbbO PCR product was assembled with PCR-linearized pBBR1MCS2 plasmid (Addgene, primers pBBR1-1F/pBBR1-1R) using an NEBuilder HiFi DNA Assembly kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: ... was PCR-amplified from plasmid pKIR1.1 (Addgene). Venus codon-optimized for expression in C ...
-
bioRxiv - Immunology 2020Quote: ... we PCR amplified TagRFP-Flag-cGAS (Addgene) by using RFP-cGAS-XbaI-F and cGAS-XhoI-R primers (Table S1) ...
-
bioRxiv - Biophysics 2023Quote: FUS was PCR-amplified from pDEST8_FLAGHA_FUS_HIS (Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... YAP5SA was amplified by PCR from Addgene #33093 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Cell Biology 2021Quote: ... Rtn4b-HaloTag was generated by inserting PCR-amplified Rtn4b from Rtn4b-GFP and PCR-amplified HaloTag from pSEMS-Tom20-HaloTag (Addgene plasmid #111135 ...
-
bioRxiv - Molecular Biology 2022Quote: The Dux promoter was amplified by PCR with PCR mix (Yeasen, 10149ES03) and then cloned into pGL4.10[luc2] (Addgene, E6651) vector ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragments amplified from pFLAG-attP (Addgene, #110095) with primers Apr fw/Apr rv and from pSEVA524 with primers tetA fw/tetA rv,25 respectively ...
-
bioRxiv - Genetics 2022Quote: ... The TDH3 promoter was PCR-amplified from Addgene plasmid #67639 (a gift from John Wyrick) ...
-
bioRxiv - Genetics 2022Quote: ... We PCR amplified the NatMX cassette from Addgene plasmid #35121 using primers with homology to the 5’ upstream and 3’ downstream sequences of the targeted gene ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product and pCS2-FLAG (AddGene 16331) were digested with EcoRI and XhoI and ligated with T4 DNA Ligase ...
-
bioRxiv - Cell Biology 2022Quote: ... A PCR product of ColX (from Addgene #110726) and a synthetic gene containing PAUF (Integrated DNA Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... The PCR products were cloned into pRAV23 (Addgene) using EcoRI and HindIII restriction sites and transformed into Top10 cells ...
-
bioRxiv - Cell Biology 2020Quote: ... a PCR product of myc-BirA* (35700; Addgene) was ligated into XhoI and SpeI cleaved pCAG-mNCad-HA ...
-
bioRxiv - Microbiology 2022Quote: ... which was PCR-amplified from pSFGFP-N1 (Addgene) [55].
-
bioRxiv - Cell Biology 2022Quote: ... The iRFP ORF was PCR amplified from Addgene plasmid #45457.
-
bioRxiv - Cancer Biology 2023Quote: ... HOXB13 was PCR amplified from pLX302_HOXB13 (Addgene #70089), digested with SalI/XbaI and ligated into linearized pENTR1A (Addgene #17398) ...
-
bioRxiv - Neuroscience 2023Quote: ... Gamillus obtained by PCR reaction from (Addgene #124837) was inserted in place of SEP with a use of NEBuilder HiFi DNA Assembly ...
-
bioRxiv - Developmental Biology 2024Quote: ... was PCR amplified from pJW2171 (Addgene plasmid #163095) and concentrated using a PCR purification kit (Qiagen) ...
-
bioRxiv - Neuroscience 2024Quote: ... A genetically encoded calcium indicator for the detection of ACh activity (1 μL, AAV9-hSyn-ACh3.0; AddGene; Watertown, MA) was infused into the medial prefrontal cortex (AP(2.7mm) ...
-
bioRxiv - Biophysics 2021Quote: ... for the live-cell time-lapse experiment and with pcDNA3.1(+)eGFP (Addgene plasmid #129020) for the FFS measurements ...
-
bioRxiv - Genetics 2021Quote: ... DNA templates for PCR-IVT were produced using overlapping oligonucleotides in a high-fidelity PCR reaction47 or using a plasmid template (Addgene #4223048) and appropriate primers46 ...
-
bioRxiv - Molecular Biology 2021Quote: ... This plasmid was used as a template for PCR and 2500ng of purified HDR template PCR product combined with 1500ng of guide RNA expression plasmid (Addgene 49330) containing the guide RNA listed in Table S4 were co-transfected into OSCs ...
-
bioRxiv - Genomics 2023Quote: ... We further replaced the Cas9 cassette with an nCas9/M-MLV-RT cassette from the pCMV-PE2 plasmid (Addgene, 132775). The lentiV2-pegRNA and lentiV2-ngRNA plasmids were constructed by replacing the Cas9 and Puromycin sequences in the lentiCRISPR v2 plasmid (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... PCR products were ligated into lentiCRISPR v2 (Addgene, 52961) using Gibson Assembly® Master Mix (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... mCherry was PCR amplified from Cas9-mCherry (Addgene #78313) and cloned into the BamHI site ...
-
bioRxiv - Cancer Biology 2020Quote: ... which was PCR-amplified from pEMS1384 (Addgene Plasmid #29304). The pHes5-d2EGFP plasmid was a gift from Ryoichiro Kageyama (Ohtsuka et al. ...