Labshake search
Citations for Addgene :
351 - 400 of 1322 citations for rno mir 22 Real Time RT PCR Detection and U6 Calibration Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The annealed oligos were then cloned downstream of a constitutively expressed U6 promoter in a lentiviral vector (lentiGuide-Hygro-mTagBFP2, Addgene, cat.# 99374) using the golden gate cloning method (Bsmb1 ...
-
bioRxiv - Neuroscience 2021Quote: ... The PX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA plasmid was a gift from Feng Zhang (Addgene plasmid # 61591) 28 ...
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: The lentiviral gRNA and pre-gRNA expressing backbones were constructed by cloning the human U6 promoter and CasRx gRNA or pre-gRNA scaffold (Addgene #109053, #109054) into lentiGuide-Puro (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... were cloned as double-stranded oligo DNA into BbsI and SapI sites in pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene; Watertown, MA, USA) modified with a Puro-T2K-GFP cassette containing puromycin-resistance by Dr ...
-
bioRxiv - Biophysics 2022Quote: ... the sgRNA construct and a polyT stretch for termination into the BamHI and XhoI restriction sites of the pAV-U6+27 plasmid (Addgene, plasmid #25709).
-
bioRxiv - Cancer Biology 2023Quote: sgRNA sequences targeting KSR1 or non-targeting control were inserted into pCAG-SpCas9-GFP-U6-gRNA (Addgene #79144, gift of Jizhong Zou). PEI transfection was used to insert pCAG-SpCas9-GFP-U6-sgKSR1 or non-targeting control into H460 and HCT116 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... and ligation into BsmBI-digested lentiCRISPRv2 as described previously.61,62 The parental vector for CRISPRi gRNA expression under a U6 promoter (pU6-gRNA-EF1alpha-puro-T2A-BFP) was a gift from Jonathan Weissman (Addgene, Cat. #60955).63,64 gRNAs were cloned by annealing complementary oligonucleotides purchased from IDT (Table S1 ...
-
bioRxiv - Cell Biology 2023Quote: ... with the murine U6 promotor controlled sgRNA expression cassette from pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid # 48138) (Ran et al. ...
-
bioRxiv - Genetics 2024Quote: ... The corresponding gRNA sequences were cloned into the pX330-U6-Chimeric BB-CBh-hSpCas9 backbone (gift from Feng Zhang; Addgene plasmid #42230) using BbsI (NEB ...
-
bioRxiv - Developmental Biology 2024Quote: DNA templates for CRISPR gRNAs were synthesized using plasmid pX335-U6- Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene, plasmid #42335; Cong et al., 2013) containing the gRNA scaffold ...
-
bioRxiv - Cell Biology 2023Quote: ... Each target sgRNA was cloned into the guide RNA-Cas co-expression plasmid px330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene, Watertown, MA, USA). A mixture of the four cloned plasmids was microinjected into the pronuclei of C57BL/6 J fertilized eggs ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... and miR 128a were inserted into the 3’UTR of pMIR luciferase reporter (Life Scientific). miR-10b reporters described previously (Ma et al. 2007) were obtained from AddGene. Reporters were co-transfected with Renilla luciferase (Promega ...
-
bioRxiv - Neuroscience 2022Quote: ... the miR-30a-shRNA cassette was then amplified and inserted into pDIO-DSE-mCherry-PSE-MCS (gift from Beatriz Rico (Addgene plasmid #129669 ...
-
bioRxiv - Cell Biology 2021Quote: The following plasmids were used: pcDNA3.1 MCS-BirAR118G-HA (Addgene #36047, gift from Dr. K. Roux, (22)) ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VP64 fragment amplified from Addgene plasmid #78897 22 with primers 986.C17 and 986.C18 to generate plasmid OA-986D (Addgene #125001); and the bottleneck promoter fragment amplified with primers 986.C13 and 986.C19 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VPR fragment amplified from Addgene plasmid #78898 22 with primers 986.C15 and 986.C12 to generate plasmid OA-986C (Addgene #125000); the Ubiquitin-63E promoter fragment amplified with primers 986.C9 and 986.C16 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VPR fragment amplified from Addgene plasmid #78898 22 with primers 986.C11 and 986.C12 to generate plasmid OA-986B (Addgene #124999); the bottleneck promoter fragment amplified with primers 986.C13 and 986.C14 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VP64 fragment amplified from Addgene plasmid #78897 22 with primers 986.C20 and 986.C18 to generate plasmid OA-986E (Addgene #125002).
-
bioRxiv - Microbiology 2019Quote: ... We introduced a single guide RNA (gRNA) targeting the 3’ region of the TgApiAT1 locus into the vector pSAG1::Cas9-U6::sgUPRT (Addgene plasmid # 54467; [34]) using Q5 site-directed mutagenesis (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... Guide RNAs were cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 plasmid backbone using a modified version of the Zhang Lab General Cloning Protocol (Addgene http://www.addgene.org/crispr/zhang/). Briefly ...
-
bioRxiv - Neuroscience 2021Quote: ... were identified by CRISPR optimal target finder (Gratz et al., 2014) and cloned into pCFD4-U6:1_U6:3tandemgRNAs (gift from Simon Bullock; Addgene plasmid # 49411; RRID:Addgene 49411) via Gibson assembly (NEB) ...
-
bioRxiv - Genomics 2023Quote: ... was generated using the pAAV-U6-sgRNA-CMV-GFP plasmid as the starting backbone (a gift from Hetian Lei, Addgene plasmid # 85451, RRID:Addgene_85451)20 ...
-
bioRxiv - Molecular Biology 2024Quote: ... were then cloned into the pCMV-RBFOX1N-dCas13e-C vector to generate the all-in-one U6-gRNA-CMV-RBFOX1N-dCas13e-C constructs (Addgene #206049 and 206050).
-
bioRxiv - Systems Biology 2020Quote: ... was used to clone a pool of four sgRNAs per gene (AGPS, SLC2A11, ZC3H7A, PDCD2L, NPM1, EPS15, hsa-mir-761, RPAP1, SYAP1, TRAF3IP1, and EGFP) into lentiCRISPR v2 (Addgene #52961). iOvCa147 cells were transduced with viral particles encoding a Cas9 and sgRNA expression cassettes ...
-
bioRxiv - Molecular Biology 2023Quote: The sequence of pri-miR-7a was amplified from mouse brain tissue and cloned into an AAV vector (Addgene Plasmid #99126), driven by a neuronal promoter (hSyn1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and lenti-HA-mBec1 F121A 22 a gift from Congcong He (Addgene plasmid # 99506; http://n2t.net/addgene:99506; RRID:Addgene_99506). To produce retroviral particles ...
-
bioRxiv - Genetics 2020Quote: ... These plasmids were constructed through multiple rounds of cloning using DNA fragments from yeast DNA or plasmids acquired from Addgene (kind gifts from John McCusker: Addgene #35121-22, from Michael Nick Boddy: Addgene #41030, from Benjamin Glick: Addgene #25444 ...
-
bioRxiv - Genomics 2023Quote: AAV production was performed by transfecting 293FT cells with 22 ug of pDGM6 helper plasmid (Addgene plasmid # 110660), 6 ug of donor template plasmid ...
-
bioRxiv - Systems Biology 2021Quote: ... individual drivers were PCR amplified out of the Cancer Pathways kit (Addgene #1000000072)21 ...
-
bioRxiv - Biochemistry 2022Quote: CRISPR-Cas9-mediated gene ablation was carried out using a guide RNA targeting Cmas exon 4 (5’-TGTCGACGAGGCCGTTTCGC-3’) in the plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid #42230 from Feng Zhang) as used before.11 TSC were cotransfected with GFP-expressing plasmid peGFP-CI (Clontech ...
-
bioRxiv - Molecular Biology 2019Quote: ... we designed and generated a CRISPR plasmid targeting the 5′– GTTTGCCCATTACTCTT/CAT(PAM:AGG)–3′ sequence using pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42260, gift from Dr. Feng Zhang), according to a published protocol (Ran et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... A 370 bp fragment of genomic DNA containing miRNA miR-34c was cloned into the Xho I and Mlu I restriction sites of the pLKO.1 vector (Addgene plasmid #52920) to express miR-34c (32) ...
-
bioRxiv - Genetics 2023Quote: ... EPP2 and RN2 cells were retrovirally transduced with shRNAmir constructs cloned into pMSCV-miR-E-PGK-Neo-IRES-mCherry backbone (LENC; Addgene plasmid #111163), and initial infection levels were determined by flow cytometry based on mCherry expression 4 days post transduction (day 0).
-
bioRxiv - Microbiology 2023Quote: ... or with the packaging plasmid pCD/NL-BH*deltavpu/RT-that lacks RT activity due to the D110E mutation in the catalytic site (kindly provided by Jakob Reiser; Addgene #136985). CA stability mutants P38A and E45A were kindly provided by Stephen Goff ...
-
bioRxiv - Developmental Biology 2021Quote: ... were designed on ZiFiT (http://zifit.partners.org/ZiFiT/) and constructed using the Joung Lab REAL Assembly TALEN kit (a gift from Keith Joung; Addgene, Cambridge, MA, #1000000017), according to the provided protocol (Sander et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... CDC45: guide#1 GCATCAGGGTCGGGCTCTGA and guide#2 GCTCTGTCCTCCCTCAACGG) were inserted into pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A) (Addgene plasmid #42335, a gift from Feng Zhang) via BbsI restriction site ...
-
bioRxiv - Neuroscience 2021Quote: The all-in-one CRISPRi lentiviral system was produced by replacing the promoter and U6 cassette of pLV-hU6-sgRNA-hUbC-dCas9-KRAB-T2a-eGFP (Addgene#71237, (Thakore et al., 2015) for the synapsin promoter by in-fusion cloning ...
-
bioRxiv - Developmental Biology 2022Quote: ... were selected and cloned into the pX335-U6-Chimeric BB-CBh-hSpCas9n (D10A) SpCas9n-expression vector to generate the sgRNAs/Cas9n vector (Addgene, #42335; (Cong et al, 2013) ...
-
bioRxiv - Cell Biology 2020Quote: ... and the parental vector for sgRNA expression under a U6 promoter (pU6-sgRNA-EF1alpha-puro-T2A-BFP) were a gift from Jonathan Weissman (Addgene, Cat# 46911 and #60955, respectively) and were described previously.15,48 sgRNAs were cloned by annealing complementary oligonucleotides purchased from IDT (Table S6 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pC015-dLwCas13a-NF expressing the catalytically inactive mutant of Cas13 (dCas13) and pC016-LwCas13a guide expression backbone (with U6 promoter) were a gift from Feng Zhang (Addgene plasmids #91902, #91905 and #91906)(Abudayyeh et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... the selected sgRNAs were subcloned into pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA plasmid (pX601) (Addgene, plasmid 61591 from Feng Zhang). The Cas9 and Cas9-Rho guide containing plasmids were packaged into AAV8 (for injections in mice ...
-
bioRxiv - Neuroscience 2023Quote: ... University of Zurich (purified by VVF as v723-9; AAV9-hCMV-HA-SpCas9, Addgene 106431, gift from Juan Belmonte [22]).
-
bioRxiv - Cancer Biology 2023Quote: ... psPAX2 was a gift from Didier Trono (Addgene plasmid # 12260; http://n2t.net/addgene:12260; RRID:Addgene_12260; accessed on 22 March 2021). pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... the BamHI-NotI fragment from GAKdY (55) was ligated into the BamHI-NotI backbone of tdEOS-paxillin-22 (plasmid #57653; Addgene), replacing the tdEOS sequence to produce plasmid paxillin-GAKdy ...
-
bioRxiv - Genomics 2022Quote: ... These sgRNAs and two non-targeting control sgRNAs were placed following the U6 promoter in a dCas9-KRAB repression plasmid (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro, Addgene; 71236, a gift from Charles Gersbach) with golden gate assembly ...
-
bioRxiv - Microbiology 2022Quote: ... targeting the desired region of the open reading frame of the tgcdpk1 gene into the pSAG1::Cas9-U6-UPRT vector (Addgene plasmid 54467; (Shen et al., 2014)) using Q5-site directed mutagenesis according to the manufacturer’s instructions (New England Biolabs) ...
-
bioRxiv - Genomics 2021Quote: ... These sgRNAs and two non-targeting control sgRNAs were placed downstream of the U6 promoter on the dCas9-KRAB repression plasmid (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro, Addgene; 71236, a gift from Charles Gersbach)15 with golden gate assembly ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid YFP-SRI was generated by sub-cloning human sorcin cDNA taken from pAd-hSRI (22) into KpnI-ApaI sites of mVenusC1 (Addgene #27794).
-
bioRxiv - Cancer Biology 2023Quote: ... pMD2.G was a gift from Didier Trono (Addgene plasmid # 12259; http://n2t.net/addgene:12259; RRID:Addgene_12259; accessed on 22 March 2021).