Labshake search
Citations for Addgene :
101 - 150 of 971 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and pCR-24xPP7SL (Addgene, Cat.No. 31864) plasmids were double digested using SpeI and NotI restriction enzymes and the 24xMS2SL (1352bp ...
-
2P-NucTag: on-demand phototagging for molecular analysis of functionally identified cortical neuronsbioRxiv - Neuroscience 2024Quote: ... GCaMP7f was PCR-amplified from Addgene plasmid #104492 with a 3’ Primer that contained sequences encoding four Alanine residues and the 2PA sequence (both in frame with the coding sequence of GCaMP7f) ...
-
bioRxiv - Biophysics 2024Quote: ... emiRFP670 were PCR amplified from Addgene Plasmid #136571 (Matlashov et al. ...
-
bioRxiv - Genetics 2022Quote: ... test set variants and libraries were cloned into pAG416GPD-EGFP-ccdB (Addgene plasmid # 14316 ; http://n2t.net/addgene:14316 ; RRID:Addgene_14316, (Alberti et al., 2007)) using Gateway cloning (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primers for individual sgRNAs were annealed and cloned into the lenti-sgRNA(MS2)_zeo backbone (Addgene #61427) using the Golden Gate cloning reaction into the BsmBI site (For primers sequences see Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers with AflII restriction sites were used to amplify sgRNA cassette from the PX458 plasmid (Addgene 48138) [21] ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157) plasmid as template DNA respectively.
-
bioRxiv - Neuroscience 2020Quote: ... amplified with a pair of primers: CCGCGAAGATCTATGAGTAAAGGAGAAGAACTTTTCAC and GGCAGTCGACCTGCAGCCGCGGCCGTTTGTATAGTTCATCCATGCCATG into pDisplay-mSA-EGFP-TM (Addgene plasmid #39863) (Lim et al. ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 51 using primers #477_R18A01_Left_primer GCTTAGCCAGATTGTTGGATGCCTG and #478_R18A01_Right_primer GCGTTATGAGGTTGTGCTGCAGATC and cloning it into pBPLexA::p65Uw [a gift from Gerald Rubin (Addgene plasmid # 26231 ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VP64 fragment amplified from Addgene plasmid #78897 22 with primers 986.C17 and 986.C18 to generate plasmid OA-986D (Addgene #125001); and the bottleneck promoter fragment amplified with primers 986.C13 and 986.C19 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VPR fragment amplified from Addgene plasmid #78898 22 with primers 986.C15 and 986.C12 to generate plasmid OA-986C (Addgene #125000); the Ubiquitin-63E promoter fragment amplified with primers 986.C9 and 986.C16 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VPR fragment amplified from Addgene plasmid #78898 22 with primers 986.C11 and 986.C12 to generate plasmid OA-986B (Addgene #124999); the bottleneck promoter fragment amplified with primers 986.C13 and 986.C14 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VP64 fragment amplified from Addgene plasmid #78897 22 with primers 986.C20 and 986.C18 to generate plasmid OA-986E (Addgene #125002).
-
bioRxiv - Synthetic Biology 2022Quote: ... was PCR amplified with NEB Q5 High-Fidelity 2X Master Mix (M0492) using primers 1157_onestep_p1 and 1157_onestep_p2. PRExpress (Akmammedov et al. 2017) was obtained from Addgene (122486). The PRE repeats of PRExpress were removed using Kpn-I and Nhe-I and purified using Zymoclean Gel DNA Recovery Kit (Genesee Scientific #11-301) ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... and hTATSF1 (amplified from K562 cDNA prepared using oligo(dT) primers) ORFs respectively into pLIX_403 (Addgene # 41395). Viral preps and selection were done as in previous section ...
-
bioRxiv - Developmental Biology 2023Quote: ... tbb-2 sequence was amplified using primers RA1792 and RA1793 and cloned into pPD95.75 (Addgene plasmid #1494) digested with EcoRI and SpeI using the NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Genetics 2021Quote: ... Cas9 and dCas-VP64 Calu-3 knock-in lines were then transduced with Brunello and Calabrese Set A libraries (Addgene #73179 and #92379) as appropriate ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...
-
bioRxiv - Neuroscience 2023Quote: ... anesthetized RiboTag RT +/+ mice were bilaterally injected with AAV5-Cre viruses (AAV sterotype 5 AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540) at the following coordinates ...
-
bioRxiv - Cell Biology 2021Quote: ... The resulting scFv fragments were further amplified using the 5’ and 3’ primers (scFv primer_s and scFv primer_as) and cloned into the psfGFP-N1 vector (Addgene #54737 ...
-
bioRxiv - Biophysics 2020Quote: We amplified OsTIR1 from pMK232 100 via PCR with the primers Cloning_OsTIR1_fw and Cloning_OsTIR1_rev and inserted it into the pLenti backbone from pLenti-CMV-rtTA3 (Addgene plasmid #26429) by digestion with BstXI ...
-
bioRxiv - Neuroscience 2020Quote: ... Lin Tian)56 using Q5 polymerase (primers: 5’-aaaagctagcatgaagacgatcatcgccctgagc-3’ and 5’-aaaaaggcgcgcctcaggttgggtgctgaccg-3’) and subcloned into pAAV.CBA.DIO (Addgene #81008)108 backbone between AscI and NheI restriction sites ...
-
bioRxiv - Microbiology 2019Quote: ... using published primers “M13/pUC Forward” (CCCAGTCACGACGTTGTAAAACG) and “L4440 Reverse” (AGCGAGTCAGTGAGCGAG) (Addgene plasmid # 1654; http://n2t.net/addgene:1654; RRID:Addgene_1654). Sequences were analyzed in Serial Cloner (v2.6 ...
-
bioRxiv - Cell Biology 2020Quote: ... using the primers GCTAGAATTGACCGGATGAGGAGAAGTGAGGTGCTG (FWD) and CATGGTGGCGACCGGTAAATTCGAAGCTTGAGCTCGAGATCTGAGGGACTGGATGTTGGTTGAATTGAGG (REV) and inserted into plasmid tgRFPt-SspB WT (Addgene number: 60415) (Guntas et al. ...
-
bioRxiv - Genetics 2020Quote: The primers ABEmax-F/ABEmax-R and AncBE4max-F/ AncBE4max-R was used to amplified pCMV_ABEmax_P2A_GFP (Addgene #112101) and pCMV_AncBE4max (Addgene #112094 ...
-
bioRxiv - Genomics 2020Quote: ... we amplified Ultramers with primers containing sequence homologous to either the STARR-seq luciferase validation vector_mP_empty (Addgene# 99298) or pGL4.23 (Promega ...
-
bioRxiv - Molecular Biology 2022Quote: ... using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291, (7)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... using pLenti_mENPP1_fwd and pLenti_mENPP1_rev primers in Table S1 and inserted into the XbaI-BamHI sites of pLenti-CMV-GFP-Puro (Addgene). To clone pLenti-CMV-mENPP1-T238A-GFP-Puro plasmid ...
-
bioRxiv - Molecular Biology 2021Quote: ... was PCR-amplified from plasmid pKIR1.1 (Addgene). Venus codon-optimized for expression in C ...
-
bioRxiv - Immunology 2020Quote: ... we PCR amplified TagRFP-Flag-cGAS (Addgene) by using RFP-cGAS-XbaI-F and cGAS-XhoI-R primers (Table S1) ...
-
bioRxiv - Biophysics 2023Quote: FUS was PCR-amplified from pDEST8_FLAGHA_FUS_HIS (Addgene plasmid no ...
-
bioRxiv - Cancer Biology 2023Quote: ... YAP5SA was amplified by PCR from Addgene #33093 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and Gibson-assembled with the HaloTag gene amplified with primers HaloTag_F and HaloTag_R (Table 1) and pFA6a-HaloTag-KanMX6 (Addgene #87029) as a template ...
-
bioRxiv - Bioengineering 2020Quote: ... VPR was amplified by primer pair VPR-F/R (template source: pWalium20-10XUAS-3XFLAG-dCas9-VPR (Addgene No.: # 78897)(Lin et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The NANOS3 gRNA expression cassettes driven by HU6 and ZU6 promoters were generated in the same manner using primer pair HU6(AgeI)_F and HU6_Nanos3gRNA(NheI)_R with gRNA_GFP-T2 (Addgene # 41820) plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157 ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequence analysis and primer design was done in Benchling [68] All of the plasmids were from Addgene (Watertown, MA) and primers (Table S2 ...
-
bioRxiv - Cell Biology 2019Quote: ... All gRNA plasmids were generated with primers listed in Supplementary Table 5 (IDT) and integrated into pX330 (Addgene #42230) vector using Zhang Lab General Cloning Protocol 29 ...
-
bioRxiv - Genomics 2020Quote: ... complete the Illumina sequencing primer sequences and add 15 bp of sequence homologous to the hSTARR-seq (Addgene #99292) plasmid for InFusion cloning ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA of APLF full length and APLFΔFHA and APLFΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) (Horn et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... its shorter isoform has been amplified from IMR90 cDNA with specific primers and cloned in pcDNA3.1(+) vector (purchased from Addgene). For overexpression studies ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-ALFA nanobody fragment was amplified using primers s15 and s16 (Table 3) from its expression vector (Addgene #189755). A pET24a-VHH-std vector (Addgene #109417 ...
-
bioRxiv - Cell Biology 2021Quote: ... Rtn4b-HaloTag was generated by inserting PCR-amplified Rtn4b from Rtn4b-GFP and PCR-amplified HaloTag from pSEMS-Tom20-HaloTag (Addgene plasmid #111135 ...
-
bioRxiv - Molecular Biology 2022Quote: The Dux promoter was amplified by PCR with PCR mix (Yeasen, 10149ES03) and then cloned into pGL4.10[luc2] (Addgene, E6651) vector ...
-
bioRxiv - Microbiology 2022Quote: ... PCR fragments amplified from pFLAG-attP (Addgene, #110095) with primers Apr fw/Apr rv and from pSEVA524 with primers tetA fw/tetA rv,25 respectively ...
-
bioRxiv - Genetics 2022Quote: ... The TDH3 promoter was PCR-amplified from Addgene plasmid #67639 (a gift from John Wyrick) ...
-
bioRxiv - Genetics 2022Quote: ... We PCR amplified the NatMX cassette from Addgene plasmid #35121 using primers with homology to the 5’ upstream and 3’ downstream sequences of the targeted gene ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR product and pCS2-FLAG (AddGene 16331) were digested with EcoRI and XhoI and ligated with T4 DNA Ligase ...
-
bioRxiv - Cell Biology 2022Quote: ... A PCR product of ColX (from Addgene #110726) and a synthetic gene containing PAUF (Integrated DNA Technologies ...