Labshake search
Citations for Addgene :
1 - 50 of 971 citations for hsa let 7f RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... a region bearing six let-7 binding sites was PCR-amplified from MSCV puro let-7 sponge (Addgene #29766) and cloned between AgeI and EcoRI sites downstream of GFP.
-
bioRxiv - Bioengineering 2023Quote: ... let-7a (Addgene #51377) using the Nucleofector V kit (Lonza ...
-
bioRxiv - Cell Biology 2023Quote: ... and let-858 3’ UTR and mKate::HA::let-858 3’UTR from pDD287 (Addgene #70685). Correct sequences of constructed plasmids were confirmed with Sanger sequencing ...
-
bioRxiv - Biophysics 2024Quote: ... pHAGE-TO-dCas9-P2A-HSA (Addgene plasmid #121936), pHAGE-EFS-MCP-HALOnls (Addgene plasmid #121937) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The 8x let-7 BS psiCHECK2 plasmid was acquired from Addgene (#20931), and the 3x miRNA BS psiCHECK2 plasmids (used in Suppl ...
-
bioRxiv - Developmental Biology 2019Quote: ... Let-7b-GFP plasmid was a gift from Sean Morrison (Addgene plasmid # 25404) (Nishino et al. ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Two DNA fragments were independently amplified with two primer sets (NLS_Fw1/Rv1, NLS_Fw2/Rv2) using pDest_pK7WG2_pRPS5A_CTP OleGFP (Addgene #171723) as a PCR template ...
-
bioRxiv - Genomics 2022Quote: ... The PCR primers and conditions are available from Addgene. The PCR product were mixed and cleaned using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Microbiology 2022Quote: ... SECN23A was amplified from pKK29 with the primer set pUC19SECN23AptF/pUC19SECN23AptR and inserted by Gibson Assembly into pUC19 (RRID:Addgene_50005) linearized with KpnI and EcoRI ...
-
bioRxiv - Synthetic Biology 2023Quote: ... a Platinum Gate TALEN assembly vector with this RVD, two DNA fragments were independently amplified with primer sets (RV_Fw1/Rv1, RV_Fw2/Rv2) and p1HD (Addgene #50664) as a PCR template ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f: Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.Chrimson.tdTomato (UNC Vector Core ...
-
bioRxiv - Developmental Biology 2021Quote: ... The GFP::AID::let-413 repair template was cloned using SapTrap assembly into vectors pDD379 (Addgene #91834) and pMLS257 ...
-
bioRxiv - Bioengineering 2020Quote: An HSA expression plasmid was obtained from Addgene (ALB-bio-His, Plasmid #52176). E400R and K383D point mutations were introduced to the HSA sequence by the Q5 site-directed mutagenesis kit ...
-
bioRxiv - Immunology 2023Quote: ... The wzm – wbbO PCR product was assembled with PCR-linearized pBBR1MCS2 plasmid (Addgene, primers pBBR1-1F/pBBR1-1R) using an NEBuilder HiFi DNA Assembly kit (NEB) ...
-
bioRxiv - Biophysics 2019Quote: ... The LRRK2 gene was cloned by using the primer sets: 5’-GCGATAACATGGCTAGTGGCAGC-3’ and 5’-GGGGTTATGCTAGTTACTCAACAGATGTTCGTCTC-3’ with pENTR221-LRRK2 (Addgene #39529) as the template ...
-
bioRxiv - Bioengineering 2022Quote: ... The hU6 promoter fragment was generated by amplifying the U6 promoter with primer set AA-MluI-U6-gib-FW/AA-U6-sg1-scaf-short-RV from the plasmid backbone pSI-359 (Addgene 131131) and the dsRed filler fragment was generated by amplifying a portion of the dsRed gene from CMVp-dsRed2-Triplex-HHRibo-gRNA1-HDVRibo-pA (Addgene 55201 ...
-
bioRxiv - Molecular Biology 2022Quote: ... we first amplified the cassettes including sgRNA using the primer set priEK-35 and priEK-37 from the CRISPRi-V2 library (Addgene #1000000093) using Phusion polymerase (New England Biolab ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP::RPT-5 translational fusion construct was created by substituting the let-858 promoter of the GFP vector pPD118.25 (L3786 was a gift from Andrew Fire; Addgene plasmid #1593 ...
-
bioRxiv - Cell Biology 2021Quote: LAMP1-GFP was amplified using PCR (using primers listed in Table S2) from Addgene plasmid #34831 and then cloned into lentiviral vector FUGW (Addgene plasmid #14883 ...
-
bioRxiv - Genetics 2021Quote: ... Putative enhancers were attached to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from POPTOP plasmid (71) (Addgene #34848) by using PCR stitching to create an enhancer reporter which was sequence verified and purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Genetics 2022Quote: ... Enhancer reporters were produced by fusing via PCR stitching these constructs to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from the POPTOP plasmid [53] (Addgene #34848). The enhancer reporters were purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Genomics 2019Quote: ... The minimal promoter and luciferase insert was prepared using biotinylated PCR primers (Amp_minPLuc2_Biotin_For and Amp_minPLuc2_Biotin_Rev) corresponding to pMPRAdonor2 (Addgene plasmid #49353) and Kapa HiFi HotStart ReadyMix (Kapa Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: LSSmKate2 and mBeRFP were individually amplified by PCR with specific primers from pLSSmKate2-N1 (Addgene #31867) and LK1-MpEF1+mBeRFP+Nos-T35S-T (gift from F ...
-
bioRxiv - Molecular Biology 2020Quote: ... crassa genomic DNA with primers 598 and 599 by PCR and inserting the PCR product into the SpeI site of Plasmid 43802 (Addgene, DiCarlo et al. 2013). The resulting plasmid was used as the template for PCR-based amplification of tef-1(P)-cas9Hs with primers 610 and 589 ...
-
bioRxiv - Cancer Biology 2020Quote: ... was used (Set A, AddGene 92379)29 ...
-
bioRxiv - Molecular Biology 2019Quote: Primers used for PCR amplification of vector inserts from existing plasmids (pL451, tdTomato, AAV from Addgene plasmid# 60229).
-
bioRxiv - Neuroscience 2020Quote: Primers containing linkers attached to each target without the PAM sequence were used for PCR with pCFD4 (RRID:Addgene_49411) as a template ...
-
bioRxiv - Cell Biology 2023Quote: ... were created via PCR amplification (see primer list) and assembled into a Spe-1 digested pCFJ151 (Addgene #19330) vector using isothermal assembly (Gibson et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... The TIS11B coding sequence was amplified from pcDNA3.1-puro-GFP-TIS11B using TIS11B MCP F and TIS11B MCP R primers and the TIAL1 coding sequence was PCR amplified from pFRT_TO_FlagHA_TIAL1 (Addgene 106090) using TIAL1 MCP F and TIAL1 MCP R primers.
-
bioRxiv - Biochemistry 2021Quote: pGN002: The ECFP encoding fragment was amplified by PCR using primers GNCA005 and GNCA006 (on pcDNA3-CFP, Addgene #13030), followed by DpnI treatment ...
-
bioRxiv - Genetics 2023Quote: ... GFP-3’UTR was PCR amplified using primers (5’-AGCTTGCATGCCTGCAGGTCG-3’ and 5’-AAGGGCCCGTACGGCCGACTA-3’) and plasmid pPD95.75 (Plasmid #1494-Addgene) as the template ...
-
bioRxiv - Cell Biology 2024Quote: mmu-mito-ncR-LDL805 (GAATTGATCAGGACATAGGGTTTGATAGTTAATATTATATGTCTTTCAAGTTCTTAG TGTTTTTGGGGTTTGGC) and hsa-mito-ncR-LDL805 (GAACGTGTGGGCTATTTAGGCTTTATGGCCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTTAGCTACCC) sequences were cloned into pZW1-Sno Vector (Addgene plasmid #73174 ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Microbiology 2024Quote: ... 782 bp PCR product obtained with primers ymCherryU and ymCherryL and pAG426-GAL-ccdb-ymCherry (a gift from Susan Lindquist (Addgene plasmid # 14155 ...
-
bioRxiv - Systems Biology 2020Quote: ... was used to clone a pool of four sgRNAs per gene (AGPS, SLC2A11, ZC3H7A, PDCD2L, NPM1, EPS15, hsa-mir-761, RPAP1, SYAP1, TRAF3IP1, and EGFP) into lentiCRISPR v2 (Addgene #52961). iOvCa147 cells were transduced with viral particles encoding a Cas9 and sgRNA expression cassettes ...
-
bioRxiv - Cell Biology 2022Quote: ... 2018 (Dolcetto CRISPRi library set A, Addgene #92385). This library contains 57,050 sgRNA ...
-
bioRxiv - Bioengineering 2021Quote: ... nanobody sequences were PCR amplified with primers containing terminal regions of homology for cloning into a pRset plasmid (Addgene plasmid 3991)(Invitrogen ...
-
bioRxiv - Plant Biology 2021Quote: ... 3356 bp upstream of the RPT2 start codon were amplified by PCR with primers 13Rb-RPT2F and 13Rb-RPT2R and cloned into the AL13Rb plasmid (Addgene # 161006) (Alamos et al. ...
-
bioRxiv - Neuroscience 2022Quote: pFUGW-NLS-FlpO was created using a PCR reaction for NLS-FlpO with primers AJ20130 - AJ20131 using pAAV hSynapsin FlpO (Addgene #60663), a gift from Massimo Scanzianis (Xue ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Synthetic enhancers were amplified by PCR with primers that included homology to the plasmid vector E1b-GFP-Tol2 (Addgene plasmid #37845)81 and were cloned upstream of the minimal promoter (E1b ...
-
bioRxiv - Plant Biology 2023Quote: A pair of oligos containing the gRNA sequence were used in conjunction with vector-specific primers (Table S1) for PCR amplification of Medicago truncatula U6 promoter and scaffold from the pUC-gRNA plasmid (Addgene #47024) using Q5® High-Fidelity 2X Master Mix (New England Biolabs) ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Neuroscience 2024Quote: ... that was first PCR amplified using custom primers (see Table 2) from a plasmid containing lexAop2 (lexAop2-myr-4xSNAPf, RRID: Addgene 87638) and then restriction digested using HindIII and PspXI (New England BioLabs ...
-
bioRxiv - Neuroscience 2019Quote: ... forward primer-5’-AGCAGCACGACTTCTTCAAGTCC and reverse primer 5’-TGTAGTTGTACTCCAGCTTGTGC (modified protocol from Addgene, USA). A known concentration (2 × 109 molecules/µl ...
-
bioRxiv - Molecular Biology 2020Quote: dCas9 repressor was PCR-amplified with primers containing SfiI sites from dCas9-KRAB-MeCP2 (a gift from Alejandro Chavez & George Church; Addgene plasmid #110821) (Yeo et al. ...
-
bioRxiv - Cancer Biology 2022Quote: The human CRISPR activation pooled library Set A (Addgene plasmid #92379 was a gift from David Root and John Doench ...