Labshake search
Citations for Addgene :
601 - 650 of 774 citations for Rat Proto oncogene Mas MAS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: For the generation of stable A549 cell lines expressing various PKCs and mutants we used following plasmids: pcDNA3-PKCε-Flag (wild-type, Addgene, Cambridge, MA), pcDNA3-Flag-K312PKCε ...
-
bioRxiv - Cell Biology 2020Quote: ... immortalized fibroblasts derived from the back skin of wildtype and LAP2α knockout littermates (Naetar et al., 2008) were transfected with the vector pSpCas9(BB)-2A-GFP (pX458, plasmid #48138 from Addgene, Watertown, MA) (Ran et al. ...
-
bioRxiv - Developmental Biology 2020Quote: The gRNA sequence for targeting p53 was cloned as double-stranded DNA oligonucleotides into the BbsI restriction site of the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene; Watertown, MA, USA) modified with a Puro-T2K-GFP cassette containing puromycin-resistance and eGFP expression by Dr ...
-
bioRxiv - Developmental Biology 2020Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
bioRxiv - Cancer Biology 2019Quote: ... Retroviral vectors encoding EGFR (Plasmid 11011 (Greulich, Chen et al., 2005)) and HER2 (Plasmid 40978 (Greulich, Kaplan et al., 2012)) were purchased from Addgene (Cambridge, MA). Stable MCF10A cell lines ectopically expressing EGFR ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Neuroscience 2019Quote: ... These were cloned in parallel into the 3’UTR of the luciferase gene in the pIS-0 vector (12178, Addgene, Cambridge, MA) [27] and DNA extracted and purified ...
-
bioRxiv - Neuroscience 2019Quote: ... constructs from UNC Vector Core (Chapel Hill, NC) or Gi-coupled hM4Di DREADDs AAV8 (AAV8-DIO-hSyn-hM4Di-mCherry) (DREADDs-AAV) construct from Addgene (Cambridge, MA). The micropipette carrying the viral particles was first located above the AC at the left hemisphere at 1.5 mm anterior to lambda and just at the edge of the skull’s flat horizon ...
-
bioRxiv - Cancer Biology 2019Quote: ... were fused downstream of the Renilla luciferase coding sequence in the broadly used pRL-TK CXCR4 6x reporter plasmid (Addgene, Cambridge, MA) as described before (10) ...
-
bioRxiv - Bioengineering 2021Quote: RNA Mango control and EXO-Probe gene fragments were synthesized (IDT) and cloned into the shRNA-expressing plasmid vector pSLQ1615 (Addgene, Watertown, MA). Plasmids were transformed into E ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene, Cambridge, MA) following the depositor’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: 8-12 weeks old Ucn3::Cre male (n =5) and female (n=3) mice were stereotaxically injected with AAV1-eF1a-DoubleFlox hChR2(H134R)-mCherry-WPRE-HgHpA (Addgene, Cambridge, MA) bilaterally into the PeFA (AP −0.6 ...
-
bioRxiv - Cell Biology 2021Quote: The same techniques were used to add fluorescent protein tags at the chromosomal loci of genes of interest using PCR fragments amplified from plasmids: pFA6a-GFP(S65ST)-KanMX6 and pFA6a-GFPEnvy-KanMX6 (Addgene, Watertown MA). Selection for positive transformants was carried out as described above and confirmed by visual analysis using wide-field fluorescence microscopy.
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6J mice received unilateral injections of AAVrg-CaMKIIα-mCherry (200 nl at 200 nl/min, titer 2×1013 vg/ml, #114469-AAVrg, Addgene, MA, USA) into the right main OB (0.5 mm lateral from midline ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: We used a virus with the Gq-coupled designer receptor exclusively activated by a designer drug (DREADD) attached to the human synapsin promoter and the m-Cherry reporter (DR, AAV2 – hSyn – hM3Dq – mCherry; Addgene, Watertown, MA), as well as an empty vector control virus (Con ...
-
bioRxiv - Molecular Biology 2022Quote: ... the ACE2 and its ECT/PD domains were cloned into pBiFC-VN155 (I152L) and pBiFC-VC155 vector(Kodama and Hu, 2010) (Addgene, MA, USA). The RBD ...
-
bioRxiv - Molecular Biology 2022Quote: AAV2/9 vectors were generated by Atlantic Gene Therapies (University of Nantes, Institut de Recherche Thérapeutique, Nantes, France) using pX600 (SaCas9-AAV) (Addgene, Watertown, MA, USA) and pAAVio-2x.sgRNA (Dmd dual sgRNA-AAV).
-
bioRxiv - Physiology 2022Quote: ... An optimized rat insulin promoter (RIP) (50) and the coding sequence of hM4D(Gi)-mCherry (Gi/o-coupled DREADD-mCherry fusion protein; Plasmid #75033; Addgene, Watertown, MA) (80 ...
-
bioRxiv - Microbiology 2022Quote: ... full length 3CLpro coding-sequences with N-terminal 6His tags were synthesized by Integrated DNA Technologies (Coralville, IA) and cloned into pET-28a(+) vector (Addgene, Cambridge, MA). Subsequently ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... that expresses the Cre-recombinase transgene in the retrograde direction (AAVrg-Syn1-EBFP-Cre; 7.6 x 1012 copies/ml; #51507-AAVrg, Addgene, Cambridge, MA, USA) in both the aPVT and pPVT using the following coordinates ...
-
bioRxiv - Neuroscience 2022Quote: ... into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL, #114469-AAVrg, Addgene, MA, USA) into the HP ...
-
bioRxiv - Neuroscience 2022Quote: ... P0-1 pups received the viral construct AAV9-hSyn-hChR2(H134R)-EYFP (200 µl at titer ≥ 1×10¹³ vg/mL, #26973-AAV9, Addgene, MA, USA) into the OB and the retrograde virus AAVrg-CamKIIα-mCherry (80 µl at titer ≥ 7×10¹² vg/mL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tag5Amyc-GSK3β S9A (constitutively active GSK3β, plasmid #16261), and Tag5Amyc-GSK3β K85A (Kinase dead GSK3β, plasmid #16262) were from Addgene (Watertown, MA). Cyclin D3 cDNA was cloned out of Rc/CMV cyclin D3 (CMV promoter ...
-
bioRxiv - Physiology 2022Quote: ... adult-onset hepatocyte-specific PPARγ knockout (PpargΔHep) and control mice were generated with AAV: AAV8-TBGp-Cre (#107787-AAV8) and AAV8-TBTp-Null (#105536-AAV8, Addgene, Watertown, MA), respectively ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: pBABEpuro-HA-MEK1 (#49328), pMM9-MAPKK2-WT (MEK2, #40805), pFLAG-CMV-hERK1 (#49328), pHAGE-MAPK1 (ERK2, #116760) were purchased from Addgene (MA, USA). Point mutations were introduced using Q5 DNA polymerase to generate the ERK1C178A ...
-
bioRxiv - Biochemistry 2022Quote: ... Plasmid pX330 for expression of human-codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA were obtained from Addgene (Cambridge, MA). The seed sequence for the SpCas9 target site in the target gene was tcggtgcagaccacctcccgcgg (underline ...
-
bioRxiv - Pathology 2019Quote: ... antisense: CGAGTTCATGACGGCGCGCA) targeting the DID domain region of INF2 was expressed using a lentiviral plasmid (Cat. no:5296, lentiCRISPRV2, Addgene, Boston, MA). All cloned plasmids were confirmed for the correct sequence by DNA sequencing (Genewiz ...
-
bioRxiv - Genomics 2019Quote: ... were seeded in a 12-well plate and cultured for 24 h before transfection with Sp1-luciferase reporter plasmid DNA (0.5 g; Panomics, Fremont, CA, USA) or a 3× ERE TATA luc construct (Addgene, Cambridge, MA, USA) for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... This vector expresses an endoplasmic reticulum (ER)-retained truncated Env-EGFP fusion protein. For linearization experiments (Fig. 5) we used plasmid pNL-EGFP/CMV/WPREdU3 (pNL-CMV-GFP) (Addgene, MA, USA). pNL4-3/Luc/Ori and pNL4-3/Luc/Kan were produced by molecular cloning into pNL4-3/Luc ...
-
bioRxiv - Systems Biology 2020Quote: ... Cells were transformed by standard lithium acetate methods to fluorescently labelled indicated organelles with monomeric Kusibara Orange 2 (mKO2) obtained from Addgene (Cambridge, MA). Peroxisomes in strains engineered with deletions of DNM1 ...
-
bioRxiv - Pathology 2020Quote: ... Lentiviral vector pLV-mCherry and vesicular stomatitis virus glycoprotein (VSV-G) expression vector pMD2.G were obtained from Addgene (Watertown, MA, USA). Coding sequence of SARS-CoV-2 S gene (GenBank ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 cell line stably expressing Flag–Rab40b-4A was created by cloning Rab40b-4A (primers purchased from IDT, Coralville, IA) into lentiviral pCS2-FLAG vector obtained from Addgene (Cambridge, MA). Cell lines were routinely tested for mycoplasma ...
-
bioRxiv - Cancer Biology 2019Quote: ... the wild-type and Δ365-371 mutant CELF1 were cloned in the pET His10 TEV LIC cloning vector (2B-T-10) (Addgene, Cambridge, MA) using NEBuilder HiFi DNA Assembly Master Mix (NEB ...
-
bioRxiv - Developmental Biology 2021Quote: ... using 500 ng of linearised plasmid that was retrieved from 5 μg of p-T3TS-nCas9n plasmid (plasmid #46757; Addgene, Cambridge, MA) digested with XbaI (New England Biolabs ...
-
Sunday driver mediates multi-compartment Golgi outposts defects induced by amyloid precursor proteinbioRxiv - Neuroscience 2021Quote: ... and EGFP cDNA were amplified by PCR and transferred into the vector pJFRC2-10×UAS-IVS-mCD8-GFP (plasmid #: 26214, Addgene, Cambridge, MA). The construct was then injected into embryos of PBac{y[+]-attP-3B}VK00033 to generate transgenic flies ...
-
bioRxiv - Cancer Biology 2021Quote: ... an annealed small interfering RNA cassette with a targeting sequence of GGACAACCCGUACAUCACC for RKTG and scramble sequences were inserted into the pLKO.1.-puro vector (Addgene, MA, USA) downstream of the U6 promoter Lentiviruses were obtained by co-transfecting a mixture of the indicated shRNA plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... human KRT19 was cloned out of pMRB101 plasmid (courtesy of Dr. Bishr Omary, Rutgers University) and cloned into pLenti CMV/TO hygro (Addgene, Cambridge, MA) using an In-Fusion HD cloning system (Takara ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pX330 plasmid for expression of the human codon-optimized Streptococcus pyogenes (Sp) Cas9 and chimeric guide RNA was obtained from Addgene (Cambridge, MA). The seed sequences for the SpCas9 target site in target genes are shown in Table S2 ...
-
bioRxiv - Cell Biology 2021Quote: ... a gift from Dr. Rick Horwitz) and EGFP-RLC (no. 35680; a gift from Dr. Tom Egelhoff) were obtained from Addgene (Watertown, MA). 1-2 μg of plasmid was used to transfect 500,000 cells in each well of a 6-well plate using Lipofectamine 2000 (5-10 μL ...
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... were cloned as double-stranded oligo DNA into BbsI and SapI sites in pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene; Watertown, MA, USA) modified with a Puro-T2K-GFP cassette containing puromycin-resistance by Dr ...
-
bioRxiv - Developmental Biology 2022Quote: ... Gene-specific TALEN constructs were assembled using the TALEN Golden Gate assembly system as described [92] with the two backbone plasmids pCS2TAL3DD and pCS2TAL3RR (Addgene, Cambridge, MA). The TALE mRNAs were generated by in vitro transcription using the mMESSAGE mMACHINE SP6 kit (Ambion ...
-
bioRxiv - Systems Biology 2023Quote: ... donor DNA constructs were chemically synthesized and cloned into the pUC19 (IRF2BP2) or pAAV-MCS2 (MYB, RUNX1, RUNX2, GFI1 and SPI1) plasmids obtained from Addgene (Watertown, MA). The donors included 400-800 bp homology arms flanking the inserted DNA sequence encoding the FKBP12 degradation tag as well as mScarlet ...
-
bioRxiv - Neuroscience 2022Quote: Pressure injections of AAV9 hSyn.jRGECO1a (totalling 0.5 × 1010 genomic copies in a volume not exceeding 200 nL, initially supplied by Penn Vector Core, PA, USA; and later by Addgene, MA, USA) and AAV2/5.GFAP.iGluSnFR.A184S (0.1 × 1010 genomic copies ...
-
bioRxiv - Cell Biology 2023Quote: ... raw files were analyzed with MaxQuant against the same database as described above including sequences of myc-BioID (Plasmid #35700, Addgene, Watertown, MA) and Streptavidin (P22629) ...
-
bioRxiv - Physiology 2023Quote: ... with the carboxy tail fused to either the N-fragment (VN) or the C-fragment (VC) of the Venus protein (27097, 22011; Addgene, Cambridge, MA), auxiliary subunits CaVα2δ ...
-
bioRxiv - Cell Biology 2023Quote: ... and used to generate constructs encoding mEmerald-RAB18 and mCherry-RAB18 by ligation into mEmerald-C1 and mCherry-C1 vectors (Addgene, Watertown, MA) using HC T4 Ligase and rapid ligation buffer (Promega ...
-
bioRxiv - Biophysics 2023Quote: ... followed by ligation in place of the mApple sequence in the mApple-CD36-C-10 vector (Addgene, Watertown, MA plasmid # 54874 (5)) ...
-
bioRxiv - Cancer Biology 2023Quote: ... third-generation EGFP transfer plasmid pHAGE-CMV-EGFP-W (EvNO00061634, Harvard Plasmid Repository) was mixed with viral envelope plasmid pMD2.G (12259, Addgene, Watertown, MA) and viral packaging plasmid psPAX2 (12260 ...