Labshake search
Citations for Addgene :
251 - 300 of 1157 citations for Rat Phosphatidic Acid Phosphatase Type 2A PPAP2A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Cancer Biology 2021Quote: ... All sgRNAs used were cloned in pSpCas9(BB)-2A-GFP (plasmid 48138, Addgene). The sgRNAs were transfected into DIPG cells using Lipofectamine 2000 (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The guide RNA was cloned into PSpCas9 (BB)-2A-GFP(PX458) (Addgene, 48138) following protocol from Ran et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNAs were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid #62988). To Make KO ...
-
bioRxiv - Immunology 2022Quote: ... to enable annealing into the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene #48138). A549 cells were transfected with PX458-containing plasmids and single-cells sorted by GFP positivity to generate clonal knockout (KO ...
-
bioRxiv - Neuroscience 2021Quote: ... UNC Vector Core) and AAV-hSyn-FLEx-mGFP-2A-Synaptophysin-mRuby (Addgene:71760) were used.
-
bioRxiv - Molecular Biology 2022Quote: ... The gRNAs were cloned into pSpCas9 (BB)-2A-puro (pX459) (Addgene, Cat. 62988). The gRNA sequences were 5’ GGATACTATTCAAGTCATCTGGG 3’ (gRNA1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The sgRNA was cloned in the pSpCas9(BB)-2A-GFP plasmid (Addgene, #48138). Then ...
-
bioRxiv - Neuroscience 2019Quote: ... gRNA was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988), which contains a puromycin cassette to facilitate selection of transfected cells ...
-
bioRxiv - Genomics 2019Quote: ... oligonucleotides encoding guide sequences were cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene). The resulting plasmid (2 μg Smarcc2_g1 or g2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The pSpCas9(BB)-2A-Puro(PX459)-V2.0 vector was obtained from Addgene (#62988). sgRNAs were designed using the CRISPOR online tool (http://crispor.tefor.net/crispor.py ...
-
bioRxiv - Molecular Biology 2020Quote: The pSptCas9(BB)-2A-Puro(PX459)-V2.0 vector was obtained from Addgene (#62988) and sgRNAs were designed using the CRISPOR online tool (http://crispor.tefor.net/crispor.py) ...
-
bioRxiv - Cell Biology 2020Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Molecular Biology 2020Quote: NLS-Cas13d-NLS was amplified from pXR001: EF1a-CasRx-2A-EGFP (Addgene # #109049) using primers ...
-
bioRxiv - Molecular Biology 2020Quote: CBP sequences were cloned into the pAC94-pmax-dCas9VP160-2A-puro vector (Addgene: 48226 ...
-
bioRxiv - Genomics 2021Quote: ... and donor plasmid pEN396-pCAGGS-Tir1-V5-2A-PuroR TIGRE (Addgene plasmid #92142) (Nora et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... the puromycin resistance gene in pSpCas9(BB)-2A-Puro (PX459; Addgene plasmid #62988)61 was replaced by either mCherry or iRFP670 using PCR and fragment assembly ...
-
bioRxiv - Microbiology 2021Quote: ... 600 ng of the lentiviral transfer vector pLenti_CMV-EGFP-2A-mNeonGreen (Addgene # 171599), and 600 ng of various viral envelope plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... with the pSpCas9(BB)-2A-GFP plasmid (Cat# 48138, Addgene, Cambridge, MA, USA) according to the manufacturer’s instructions (34) ...
-
bioRxiv - Cell Biology 2020Quote: ... program X-005 with the pSpCas9(BB)-2A-Puro (PX459) vector (Addgene, #62988) bearing the appropriate targeting sequence (KIF21B ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pCW57-GFP-2A-MCS plasmid was a gift from Adam Karpf (Addgene plasmid # 71783 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Gene-specific gRNAs were integrated into pSpCas9(BB)-2A-GFP (PX458) (Addgene #48138) and 2 μg of plasmid was electroporated into 106 cells using a Lonza 4D-NucleofectorTM according to the manufacturer’s protocol for HCT116 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid #62988 ...
-
bioRxiv - Cell Biology 2021Quote: ... The pSpCas9 (BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138 ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-GFP was a gift from Feng Zhang (Addgene plasmid #48138). pSpCas9(BB)-2A-mCherry was constructed by replacing GFP with mCherry ...
-
bioRxiv - Neuroscience 2022Quote: ... AAACCTGAGCCCGCGACCACACCC –bottom for Sox21NHEJ5) were cloned into pSpCas9(BB)-2A-Puro (px459; Addgene) and designated the plasmid as pX459-Sox21NHEJ4 and pX459-Sox21NHEJ5 ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR-Cas9 plasmids were as follows: pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene 62988 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Plasmid pLdCH-hyBE4max (Figure 2A) was generated by amplifying hyBE4max (Addgene #157942, (38)) using primer 1008F and 1007R and cloning it into AgeI and FseI sites of pLdCH (Addgene #84291 ...
-
bioRxiv - Molecular Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9: plenti-EF1a-Cas9-2A-blast and pXPR047 (Cas9-GFP reporter, Addgene# 107145) plasmids were provided by Dr ...
-
bioRxiv - Developmental Biology 2023Quote: ... and cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene # 62988). Both donor and sgRNA plasmids for SIX2 reporter knockin were transfected into the H1 hESCs using the Lipofectamine 3000 Transfection Reagent (Invitrogen ...
-
bioRxiv - Developmental Biology 2023Quote: ... the pSpCas9 (BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988, Addgene, Teddington, UK) was modified by an EF1alpha promoter25 ...
-
bioRxiv - Genomics 2023Quote: ... This gRNA was cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) via the Zhang lab protocol (https://media.addgene.org/data/plasmids/62/62988/62988-attachment_KsK1asO9w4owD8K6wp8.pdf) ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Microbiology 2023Quote: S10-3 cells were transfected with the pSpCas9(BB)-2A-GFP (Addgene #48138) plasmid encoding the Cas 9 protein fused to GFP by the 2A peptide ...
-
bioRxiv - Molecular Biology 2023Quote: ... the vector pSpCas9n(BB)-2A-GFP (PX461) (Addgene, Watertown, MA, USA, Cat # 48140) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... based on an AAVS1 SA-2A-puro-pA donor (plasmid no. 22075; Addgene), was generated by replacing the puromycin resistance gene with the neomycin resistance gene and cloning a cassette containing the Tet-On 3G promoter driving the human NGN2 complementary DNA followed by P2A ...
-
bioRxiv - Cancer Biology 2023Quote: ... The gRNAs were cloned into either pSpCas9(BB)-2A-GFP (Addgene Plasmid #48138) or pSpCas9(BB)-2A-mCherry as described previously (Ran et al ...
-
bioRxiv - Molecular Biology 2023Quote: pSpCas9(BB)-2A-GFP was a gift from Feng Zhang (pX458, Addgene #48138;) (Ran et al ...
-
bioRxiv - Cell Biology 2023Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mito-RFP tracker (Plasmid #51013) was from Addgene (pLenti.CAG.H2B-cerFP-2A-mito-dsRFP.W). Viafluor-488 live cell microtubule staining kit (Biotium ...
-
bioRxiv - Molecular Biology 2024Quote: ... pSpCas9(BB)-2A-Puro (PX459) V2.0 was a gift from Feng Zhang (Addgene plasmid # 62988 ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV-CMV-TVAmCherry-2A-oG was a gift from Marco Tripodi (Addgene #104330) (Ciabatti et al ...
-
bioRxiv - Cell Biology 2023Quote: ... and pSpCas9(BB)-2A-Puro (PX459) a gift from Feng Zhang (Addgene # 48139) (Kirschke et al. ...
-
bioRxiv - Genomics 2024Quote: ... and 6 were generated from pSpCas9(BB)-2A-Puro (PX459 V2.0, Addgene #62988) via insertion of spacer sequences into the BbsI cloning site (#R3539L ...
-
bioRxiv - Microbiology 2023Quote: ... and pBTK401 (Type 8) (Addgene_65109 ...
-
bioRxiv - Physiology 2023Quote: ... Rat cacna2d1 (RRID: Addgene_26575) and cacna1a were gifts from D ...
-
bioRxiv - Genetics 2021Quote: GFP-expressing pSpCas9(BB)-2A-GFP (PX458) (gift from Feng Zhang, Addgene plasmid #48138). Three crRNAs targeting human TMEM67 (RefSeq NM_153704.5 ...