Labshake search
Citations for Addgene :
501 - 550 of 1157 citations for Rat Phosphatidic Acid Phosphatase Type 2A PPAP2A ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The pCW57-GFP-2A-MCS plasmid was a gift from Adam Karpf (Addgene plasmid # 71783; http://n2t.net/addgene:71783; RRID:Addgene_71783). pGFP-P2A-CFTR-WT-T7 was mutagenized to delete the coding sequence in CFTR exon 23 ...
-
bioRxiv - Developmental Biology 2021Quote: ... RD cells were transfected with the all-in-one Cas9/gRNA plasmid pSpCas9 BB-2A-GFP (PX458; Addgene; gRNA target sequence ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... sequences to target the MYC gene in the proximity of the BR-coding region were designed using the online software CRISPR Design Tool (http://crispr.mit.edu/) and cloned as DNA inserts into pSpCas9 (BB)-2A-GFP (PX458) (Addgene plasmid # 48138 ...
-
bioRxiv - Neuroscience 2021Quote: Kir was amplified by PCR from pCAG-Myc-Kir2.1E224G/Y242F-2A-EGFP (similar to pCAG-Kir2.1-T2A-tdTomato, Addgene #60598 ...
-
bioRxiv - Molecular Biology 2020Quote: ... was derived from E14 mouse ES cells and is homozygous for a Tir1-2A-Puro cassette (Addgene plasmid # 92142; http://n2t.net/addgene:92142; RRID:Addgene_92142) at the TIGRE locus.
-
bioRxiv - Molecular Biology 2021Quote: pTRIP-SFFV-mtagBFP-2A STING and the parental empty vector were a gift from Nicolas Manel (respectively, Addgene plasmid # 102586 ...
-
bioRxiv - Neuroscience 2019Quote: ... 5’-CTTCTAAAATGGGTGGCATA-3’ was designed using the CRISPR design tool (http://crispr.mit.edu) from the Zhang laboratory and cloned into plasmid pSpCas9(BB)-2A-Puro (Px459) V2.0 (Addgene, 62988). Plasmid constructs were purified with the Endo-free Plasmid Maxiprep kit (Qiagen) ...
-
bioRxiv - Genetics 2019Quote: ... Cells were co-transfected with luciferase reporter plasmids (Figure 2A) or a positive control (pAP1-3, Addgene 71258) and a renilla normalisation control (pGL4.74 ...
-
bioRxiv - Molecular Biology 2019Quote: ... upstream and downstream sgRNAs were cloned under an U6 promoter into the pSpCas9(BB)-2A-GFP (Addgene #48138) and the pSpCas9(BB)-2A-mCherry (generated in house ...
-
bioRxiv - Cell Biology 2019Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene_48138). HeLa cells stably expressing C2-His6 or C2-Flag were generated by lentiviral transduction ...
-
bioRxiv - Molecular Biology 2021Quote: ... The two sgRNAs targeting Dazl exon 6 were cloned into the pSpCas9(BB)-2A-GFP backbone (Addgene #48138). The knock-in led to the generation of a reporter cell line named Dazl-mScarlet-HygromycinR (DASH) ...
-
bioRxiv - Cell Biology 2021Quote: ... candidate gRNAs were cloned into the pSpCas9(BB)-2A-GFP (PX458) plasmid vector (Addgene plasmid #48138; RRID: Addgene_48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... candidate gRNAs were cloned into the pSpCas9(BB)-2A-GFP (PX458) plasmid vector (Addgene plasmid #48138; RRID: Addgene_48138) (Ran et al. ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene_48138) and was described previously49 ...
-
bioRxiv - Neuroscience 2020Quote: ... pSpCas9n(BB)-2A-GFP (PX461) and pX330-U6-Chimeric_BB-CBh-hSpCas9 were a gift from Feng Zhang (Addgene plasmid # 48140 ...
-
bioRxiv - Molecular Biology 2021Quote: ... EF1a-dCasRx-2A-EGFP was a gift from Patrick Hsu (Addgene plasmid # 109050; http://n2t.net/addgene:109050; RRID:Addgene_109050)) using oligonucleotides noted in Table S4 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the following sequences were cloned into pSpCas9(BB)- 2A-Puro (PX459) V2.0 (gift from Feng Zhang, Addgene #62988) targeting mouse Col6a1 ...
-
bioRxiv - Cell Biology 2022Quote: ... The vector pSpCas9(BB)-2A-Puro (PX459) V2.0 was provided from Feng Zhang (plasmid 62988; Addgene, Cambridge MA) (Ran et al ...
-
bioRxiv - Cell Biology 2022Quote: ... annealed oligo (5’-CACCGATGACCAACGACGCAAGTTT-3’ and 5’-AAACAAACTTGCGTCGTTGGTCATC-3’) was inserted into PX459 (pSpCas9(BB)-2A-PuroV2.0) (Addgene) (Ran et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... pSpCas9(BB)-2A-Puro (PX459) was a gift from Feng Zhang (Addgene plasmid # 48139 ; http://n2t.net/addgene:48139 ; RRID:Addgene_48139)50 The sgRNA oligos (sense ...
-
bioRxiv - Systems Biology 2022Quote: pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138; http://n2t.net/addgene:48138; RRID:Addgene_48138). The oligonucleotides containing CRISPR guide RNA sequences (sgRNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... mouse and human sgRNAs were designed using the CHOPCHOP web tool: (http://chopchop.cbu.uib.no) and cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139) and lentiCRISPRv2 (Addgene #52961).
-
bioRxiv - Cell Biology 2019Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138; http://n2t.net/addgene:48138; RRID:Addgene_48138).
-
bioRxiv - Cancer Biology 2019Quote: ... was created using pSpCas9(BB)-2A-GFP (a gift from Dr. Feng Zhang, #48138, Addgene, http://n2t.net/addgene:48138 ; RRID:Addgene_48138) as a backbone vector [12] ...
-
bioRxiv - Cancer Biology 2019Quote: ... and ligated into the pSpCas9(BB)-2A-EGFP vector (pX458; a gift from Feng Zhang; Addgene Plasmid #48138) at the BbsI cloning site ...
-
bioRxiv - Developmental Biology 2019Quote: ... Annealed guides were then cloned into the pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene, plasmid 62988, PMID: 24157548). Ark -/- MEFs were transfected with 4 guide pairs in order to create the desired deletion using FUGENE (Promega ...
-
bioRxiv - Molecular Biology 2020Quote: ... and was inserted into BpiI sites of a pSpCas9(BB)-2A-Puro (PX459) V2.0 plasmid (Addgene, Plasmid #62988). All sgRNAs used in the present study were designed using CRISPR DESIGN (http://crispr.mit.edu/ ...
-
bioRxiv - Biochemistry 2019Quote: ... The sgRNA oligos were then cloned into the pSpCas9(BB)-2A-GFP (PX458) vector (a kind gift from Feng Zhang [Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene_48138]). Jurkat T cells (clone E6-1 ...
-
bioRxiv - Genetics 2020Quote: ... sgRNAs designed using the CRISPR Design Tool (http://crispr.mit.edu) were cloned into pSpCas9(BB)-2A-Puro (Addgene #48139) and transfected using Polyfect (Promega) ...
-
bioRxiv - Physiology 2021Quote: ... was used for sgRNA-generation from the pSpCas9(BB)-2A-GFP (PX458) plasmid (Addgene, Watertown, Massachusetts, USA, #48138) from F ...
-
bioRxiv - Cell Biology 2020Quote: MCF10A cells were transfected via PEI (https://www.addgene.org/protocols/transfection/) with pSpCas9(BB)-2A-GFP (PX458) - (Addgene #48138) carrying sgRNA for hSLC9A1 KO 5’-GTTTGCCAACTACGAACACG (SLC9A1:HGLibA_45399 ...
-
bioRxiv - Cell Biology 2019Quote: ... phosphorylated oligonucleotides containing each target sequence into BbsI-digested pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) 46 ...
-
bioRxiv - Biochemistry 2020Quote: ... was designed by using http://crispr.mit.edu and cloned into the BbsI site of pSpCas9 (BB)–2A–Puro (PX459, Addgene). HeLa cells were transiently transfected with the PX459–sgRNF213-exon3 vector using FuGENE 6 Transfection Reagent (Promega) ...
-
bioRxiv - Immunology 2020Quote: ... gRNAs were cloned into the pSpCas9(BB)-2A-GFP (PX458) plasmid (a gift from F. Zhang; Addgene, #48138) as described elsewhere [33] and Jurkat cells were transfected with either empty vector or the gRNA-encoding construct using the Nucleofector Solution 2M (5 mM KCl ...
-
bioRxiv - Cell Biology 2021Quote: ... The pSpCas9 (BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138; http://n2t.net/addgene:48138; RRID:Addgene_48138). The gRNA sequences used for CEP90 and MNR were 5′-GATGAGGAAATATCATCCGT-3′ and 5′-GTATAAAATACCCGACCACA-3′ respectively.
-
bioRxiv - Cancer Biology 2022Quote: ... ADAR2-targeting gRNAs were cloned into the Cas9-expressing mammalian expression vector pSpCas9(BB)-2A-Puro PX459 (AddGene#158112 ...
-
bioRxiv - Cancer Biology 2022Quote: Single guide RNA sequences targeting murine Lrp1 were obtained from the GeCKO v2 library (35) and cloned into the pSpCas(BB)-2A-Puro (PX459) V2.0 vector (RRID:Addgene_62988). B16F10-TR-shApoe cells were plated into a 6-well dish the day prior to transfection and transfected with 4 μg plasmid and TurboFect transfection reagent (Thermo Scientific ...
-
bioRxiv - Cell Biology 2022Quote: We replaced the ORF of the GFP marker in the pSpCas9(BB)2A-GFP plasmid (Addgene plasmid #48138) by the ORF of iRFP670 ...
-
bioRxiv - Microbiology 2022Quote: ... EF1a-CasRx-2A-EGFP was a gift from Patrick Hsu (Addgene plasmid # 109049 ; http://n2t.net/addgene:109049 ; RRID:Addgene_109049). Following oligos were used for cloning ...
-
bioRxiv - Molecular Biology 2023Quote: The gRNAs used to knock-out LIG4 were cloned in the pSpCas9(BB)-2A-GFP (pX458) (Addgene #48138). The gRNA used for IncucyteS3 experiments was cloned into a pLenti-gRNA-GFP-2A-PURO gift from Jordan Young from Repare Therapeutics ...
-
bioRxiv - Neuroscience 2022Quote: ... Lipofectamine3000 was used to transfect cells with 0.5ug of pSpCas9(BB)-2A-GFP(PX458) targeting plasmid (Addgene # 48138) containing sgRNA sequences targeting full-length or truncations in SRRM2 and PNN (Supplemental Table 3) ...
-
bioRxiv - Cell Biology 2022Quote: Plasmids encoding GFP-2A-ORF6 were generated by inserting EGFP-T2A sequence (copied from Addgene #140424 by PCR) at the 5’ end of the ORF6 gene in pSecTag2 mammalian expression vector using Gibson Assembly ...
-
bioRxiv - Cell Biology 2022Quote: ... pSpCas9(BB)-2A-Puro (PX459) and lentiCRISPR v2 were gifts from Feng Zhang (Addgene plasmids #48139 and #52961). pLG1-puro non-targeting sgRNA 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 17 as a template and inserted into pXR002: EF1a-dCasRx-2A-EGFP (a gift from Patrick Hsu; Addgene plasmid #109050 ...
-
bioRxiv - Molecular Biology 2023Quote: pSpCas9(BB)-2A-Puro (PX459) was a gift from Feng Zhang (Addgene plasmid #48139; http://n2t.net/addgene:48139;RRID:Addgene_48139). Cas9 sgRNAs targeting the RTCB gene were cloned as previously described (table S2 ...
-
bioRxiv - Molecular Biology 2023Quote: ESCs were co-transfected with 1000 ng of pX458 SpCas9(BB)-2A-GFP vector (Addgene #48138, contains eGFP)80 and 500 ng of vector co-expressing four sgRNAs to the Peg13 DMR CTCF region (contains DsRed ...
-
bioRxiv - Genetics 2023Quote: ... Guide RNAs TTCTTCAGACTTCAGAACAT or CTGAAGAAAATTTACAAATC were cloned into the pSpCas9(BB)-2A-GFP plasmid (pX458; Addgene plasmid 48138) and used in a co-transfection ...
-
bioRxiv - Biophysics 2023Quote: ... The gRNA sequence (GCGGCCGGGCTCCATGGCGC) was cloned into pSpCas9(BB)-2A-GFP (Addgene, PX458; deposited by Dr. Feng Zhang). The replacement DNA was designed to contain 700 bps of the homologous region for both sides of the inserted mEos2 sequence ...
-
bioRxiv - Bioengineering 2022Quote: ... the annealed gRNA oligos were cloned into the BbsI site of the pSpCas9(BB)-2A-BSD plasmid (Addgene plasmid # 118055 ...
-
bioRxiv - Developmental Biology 2023Quote: ... pSpCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138; http://n2t.net/addgene:48138; RRID:Addgene_48138).