Labshake search
Citations for Addgene :
401 - 450 of 2187 citations for Rat Epithelial Discoidin Domain Containing Receptor 1 DDR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... 600nl of a viral vector containing either pAAV5-hSyn-hM4D(Gi)-mCherry (hM4Di; Addgene viral prep ...
-
bioRxiv - Genetics 2020Quote: ... gRNA-containing plasmids were generated in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene; 62988) (Ran et al ...
-
bioRxiv - Biochemistry 2021Quote: ... as a guide RNA (gRNA) and electroporated into HME63 already containing pCas9 (Addgene: 42876). The dnaB gRNA was designed to be centered on the desired mutation site and at the closest adjacent PAM sequence (5’-NGG) ...
-
bioRxiv - Immunology 2021Quote: The mammalian expression plasmid containing SARS-CoV-2 HexaPro spike was obtained from Addgene (Addgene plasmid # 154754 ...
-
bioRxiv - Immunology 2022Quote: ... a plasmid containing the promoter region of Mus musculus iNos was obtained from Addgene (pGL2-NOS2 Promoter-Luciferase – Plasmid # 19296 from Charles Lowenstein).44 The following primers were designed and used to amplify the promoter for the gene of interest and incorporate XhoI and BamHI sites at the 5’ and 3’ ends ...
-
bioRxiv - Molecular Biology 2023Quote: ... wild-type MEFs were transduced with lentiviral particles containing the plasmids lentiMPHv2 (Addgene #89308) and lentiSAMv2 (Addgene #75112) ...
-
bioRxiv - Bioengineering 2023Quote: ... coli were transformed with plasmid containing the ampicillin resistance gene (pUC19, Addgene Plasmid #50005) and streaked on LB agar plates spiked with 100 µg/mL ampicillin ...
-
bioRxiv - Immunology 2023Quote: ... pLentiCRISPR-v2 containing guides were transfected wiTHPSPAX2 (Addgene #12260, a gift from Didier Trono) and pMD2.G to generate lentiviral particles ...
-
bioRxiv - Cancer Biology 2023Quote: ... Separate lentivectors containing spCas9 (lentiCas9-Blast a gift from Feng Zhang (Addgene plasmid # 52962) and sgRNA (lentiGuide-Puro a gift from Feng Zhang (Addgene plasmid # 52963 ...
-
bioRxiv - Cell Biology 2023Quote: ... The CYFIP2-mCherry containing plasmid was a gift from Josef Kittler (Addgene plasmid # 122052). The ECFP-betaPIXa containing plasmid was a gift from Rick Horwitz (addgene #15235) ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing scFvs targeting TNFRSF8 or TMPRESS11E were cloned into pSLCAR-CD19-BBz (Addgene #135992) using NEB HiFi DNA assembly ...
-
bioRxiv - Cancer Biology 2023Quote: ... All plasmids containing the CD19 targeting ABD FMC63 are available from Addgene (#200670-#200681).
-
bioRxiv - Biochemistry 2023Quote: Plasmids containing human BRCA1 cDNA were a gift from Junjie Chen (Addgene, Plasmid #99394). We cloned the BRCT and RING variant library by designing primers (Sigma-Aldrich ...
-
bioRxiv - Genomics 2023Quote: ... oligos containing the CRISPR sequence of YBR209W were inserted into pWS082 (Addgene plasmid #90516), the template plasmid of sgRNA cassette ...
-
bioRxiv - Genomics 2023Quote: ... oligos containing the CRISPR sequence (table S1) were inserted into pWS082 (Addgene plasmid #90516), the template plasmid of sgRNA cassette ...
-
bioRxiv - Microbiology 2023Quote: ... coli BL21(DE3) expression strains containing GST-Hsp90 N(9–236) plasmid (Addgene: 22481) were grown in 1 l LB media supplemented with 100 μg/ml ampicillin at 25 °C and shaking (200 r.p.m. ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a pcDNA3.1-based plasmid containing a C-terminal 3xFLAG-V5 tag (Addgene 87063) for all other variants ...
-
bioRxiv - Synthetic Biology 2024Quote: Phagemid-containing supernatants were added to 2.5 mL S2060 cells (streptomycin-resistant, Addgene #105064) grown to OD600 = 0.5 and allowed to infect at 37 °C and 250 rpm for 1 h ...
-
bioRxiv - Cancer Biology 2024Quote: ... Plasmids containing pMSCVhygro-Ezh2 (#24926) or pMSCVhygro-Ezh2-F667I (#24927) were purchased from Addgene. Vectors encoding wild type TRα1 (pCMV-Flag-TRα1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Oligonucleotides containing gRNA sequences were first cloned into sgRNA expression vectors (Addgene #53186-53189) and then multiple gRNA cassettes were cloned into lentiviral expression vectors (pLV hUbC-Cas9-T2A-GFP ...
-
bioRxiv - Cell Biology 2020Quote: ... The PMXS retroviral vector containing the coding sequence for SLC1A3 was purchased (Addgene; Plasmid #7287340). The mammalian expression vector containing the coding sequence for EB1-2xEGFP was purchased (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... ID8 cells were subsequently transfected with luciferase containing construct pHIV-Luciferase #21375 4.5 µg (Addgene) to generate the ID8-luc cells ...
-
bioRxiv - Neuroscience 2019Quote: ... the human TSC1 gene was PCR amplified from a vector containing the hTSC1 cDNA (Addgene) 70 ...
-
bioRxiv - Biophysics 2020Quote: The plasmid containing aS gene was a kind of gift from HilalLashuel (Addgene plasmid # 36046)67 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors containing Cre-inducible GCaMP6f (AAV.9.Syn.Flex.GCaMP6f.WPRE.SV40, Addgene; TIter≥2.1×13 GC/ml) were injected into the right DLS or DMS by stereotaxic surgery ...
-
bioRxiv - Cell Biology 2019Quote: ... A plasmid containing a mTurquoise2-H2A sequence (a gift from Dorus Gadella, Addgene plasmid #36207)39 was PCR amplified to append BamHI and NotI restriction sites (Forward ...
-
bioRxiv - Molecular Biology 2022Quote: ... a 2 mL transfection mixture containing lentiviral packaging plasmids 7.5 µg pMD2.G (#12259, Addgene), 11.4 µg pMDLg-RRE (#12251 ...
-
bioRxiv - Neuroscience 2022Quote: The pmNFM plasmid containing cDNA encoding for NFM was a gift from Anthony Brown (Addgene plasmid #83126 ...
-
bioRxiv - Cell Biology 2022Quote: ... TP53 was knocked-out in hCEC by transfection with a Cas9 containing plasmid (Addgene #42230) and plentiGuide-Puro expressing the following sgRNA ...
-
bioRxiv - Genetics 2021Quote: pWallium-dCas9-VPR (containing homo sapien codon optimized dCas9m4; Addgene# 78897 (Lin et al., 2015)) was digested with NdeI/EcoRI ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Genomics 2022Quote: ... Cells were transfected with 20μg of ISG-knockout llibrary containing 15416 sgRNAs (Addgene, Cat # 125753), 10μg and 15μg of second-generation lentiviral packaging plasmid psPAX2 (Addgene ...
-
bioRxiv - Microbiology 2020Quote: The following cDNA sequence containing plasmids were obtained: hACE2 (Addgene, #1786, gift from Hyeryun Choe), TMPRSS2 (Addgene ...
-
bioRxiv - Cell Biology 2021Quote: FRET biosensor containing vectors: pTriEx4-Rac1-2G (Addgene plasmid # 66110 ; http://n2t.net/addgene:66110 ; RRID:Addgene_66110) and pTriExRhoA2G (Addgene plasmid # 40176 ...
-
bioRxiv - Developmental Biology 2022Quote: ... a dCas9-KRAB was cloned into a piggyBac transposon containing ampicillin and puromycin resistance (Addgene) which was obtained from the Wysocka Lab at Stanford University ...
-
bioRxiv - Cancer Biology 2022Quote: ... media was replaced with media containing lentivirus corresponding to the lentiGuide-Puro plasmid (Addgene #52963), encoding the sgRNA of interest (sequences below) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Plant Biology 2022Quote: ... Each of the gRNA containing shuttle vectors were then assembled into pDGE666 (Addgene plasmid # 153231) using BsaI golden gate assembly ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.8 μl of AAV solution containing pZac2.1 gfaABC1D-cyto-GCaMP6f (Addgene viral prep # 52925-AAV5) was injected at 100 nL/min by means of a hydraulic injection apparatus driven by a syringe pump (UltraMicroPump ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Neuroscience 2023Quote: ... the pipette containing AAVPHP.S-CAG-FLEX-tdTomato virus (Addgene 28306-PHP.S, 1.8×1013 vg/mL) targeted at 2 locations in the mandibular branch spaced 250 um apart ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.4 μl of AAV solution containing pZac2.1 gfaABC1D-cyto-GCaMP6f (Addgene viral prep # 52925-AAV5) was injected at 50 nL/min using a hydraulic injection apparatus driven by a syringe pump (UltraMicroPump ...
-
bioRxiv - Bioengineering 2023Quote: ... containing the primary or a fragment of the primary miR sequences were obtained from Addgene as stab cultures ...
-
bioRxiv - Cell Biology 2023Quote: ... pTGL0386 containing KRAB and dCas9 for CRISPRi (a gift from Jorge Ferrer, Addgene plasmid #118154); pCRISPRi0001 containing gRNA 5’ GTGCTAAAGGAGCCCGGCGG 3’ cloned into pTGL0386 ...
-
bioRxiv - Cell Biology 2023Quote: ... sgRNA guides were cloned into lentiCRISPR-V2 plasmids containing the puromycin resistance vector (Addgene, 98290), transformed into Stbl3 competent E ...
-
bioRxiv - Systems Biology 2023Quote: Lentiviral particles containing pLentiPGK-Hygro-DEST-H2B-mCerulean3 (kind gift from Markus Covert44; Addgene: 90234) vector were produced in HEK293T (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: Each gRNA was cloned into a plasmid containing spCas9 and EGFP sequences (PX458; Addgene 48138) (Ran et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... miniTurbo containing plasmid 3xHA-miniTurbo-NLS_pCDNA3 was a gift from Alice Ting (Addgene plasmid # 107172). miniTurbo gene (primers ...
-
bioRxiv - Systems Biology 2024Quote: ... pPBbsr-JNKKTR-mCherry plasmid containing JNK activity reporter (JNK-KTR) was obtained from Addgene (#115493). mCherry in this plasmid was exchanged with iRFP713 (from Addgene #111510 ...