Labshake search
Citations for Addgene :
201 - 250 of 2187 citations for Rat Epithelial Discoidin Domain Containing Receptor 1 DDR1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Immunology 2023Quote: ... coli containing the pMF230 plasmid containing a constitutively active promoter and eGFP were ordered from Addgene and cultivated on 100 uM ampicillin LB agar plates ...
-
bioRxiv - Developmental Biology 2020Quote: ... and MiniP containing pEMS1172 (Addgene, #29301), pEMS1375 (Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: - 22.1ug sgRNA containing pXPR_053 (Addgene 113591).
-
bioRxiv - Molecular Biology 2021Quote: Lentivirus containing dCas9-TET1 (#84475, Addgene) or dCas9-dTET1 (#84479 ...
-
bioRxiv - Microbiology 2023Quote: ... Electrocompetent cells containing pREDCas9 (Addgene #71541) were generated as previously described[68] ...
-
bioRxiv - Genomics 2023Quote: ... containing either miRFP670 (Addgene plasmid #163748) or tagBFP (Addgene plasmid #163747 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats in control groups received either rAAV5/hSyn-DIO-mCherry (Addgene #50459, 0.75μl), saline (1.2μl ...
-
bioRxiv - Cancer Biology 2024Quote: ... DIV6 rat cortical neurons were treated with AAV-mDlx-NLS-mRuby (Addgene #99130) at a titer of >1x109 vg/ml.121 AAV-mDlx-NLS-mRuby2 was a gift from Viviana Gradinaru (Addgene plasmid #99130 ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Pathology 2020Quote: ... all inserts were sub-cloned to an expression vector containing hygromycin resistance (pLenti CMV Hygro DEST 117-1, Addgene) using the Gateway recombination system ...
-
bioRxiv - Biochemistry 2021Quote: A 20 μL reaction containing 150 ng of a plasmid containing two loxP sites (Addgene Plasmid #26852) and 500 nM of Cre or Cre mutants in recombination buffer (50 mM Tris-Cl ...
-
bioRxiv - Microbiology 2019Quote: ... 2.18 μg of env-defective HIV-1 provirus containing GFP reporter was cotransfected with 0.31 μg pMD2.G VSV G plasmid (Addgene #12259). Simian immunodeficiency virus (SIV)−VLPs containing Vpx were produced by the transfection of 2.18 μg pSIV−Δpsi/Δenv/ΔVif/ΔVpr (Addgene #132928 ...
-
bioRxiv - Synthetic Biology 2019Quote: We first obtained the yeast strain containing the reporter gene by integrating (lexA-box)x-PminCYC1-Citrine-TCYC1 plasmids (x = 4, 2 or 1) (Addgene plasmids #58434 ...
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Neuroscience 2023Quote: ... E15 wild-type embryos were unipolar injected into the ventricle using a pulled glass micropipette containing a DNA solution (1 μg/μl CAG-GFP plasmid (11150, Addgene) with 0.03% Fast Green in PBS) ...
-
bioRxiv - Neuroscience 2023Quote: ... LR reaction was performed using R83B04 containing entry vector and lexA containing (pBPLexA::p65Uw) destination vector (Addgene: 26231). Transgenic fly generation was conducted by GenetiVision ...
-
bioRxiv - Neuroscience 2022Quote: ... ChAT-Cre or WT rats were injected with pAAV5-hSyn-hM3D(Gq)-mCherry (Addgene) at a titer of 1.5×1013 GC/mL ...
-
bioRxiv - Neuroscience 2022Quote: ... ChAT-Cre rats were injected with pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, USA) at a titer of 7.8-8.2×1012 genome copies (GC)/mL ...
-
bioRxiv - Neuroscience 2023Quote: ... rats received infusions of 500 nL of AAV5-hsyn-ChR2-eYFP (n= 22; Addgene 26973 ...
-
bioRxiv - Microbiology 2020Quote: ... A plasmid containing the ACE2 gene (Addgene) was digested with Nhe I and Kpn I and the fragment was ligated into the similarly digested pLenti-III-HA vector plasmid ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids containing sirtuins were ordered from Addgene, and all of them were produced by Eric Verdin ...
-
bioRxiv - Molecular Biology 2021Quote: ... a vector containing 24xMS2v6 (Addgene Plasmid #104391) was double-digested and the MS2 cassette was gel purified ...
-
bioRxiv - Immunology 2021Quote: ... along with the DHFR containing vector (Addgene) to produce 2H1-mIgG3-CH1a-1 ...
-
bioRxiv - Genomics 2021Quote: ... gene fragment containing CTT pegRNA (Addgene #132778) was PCR amplified using primer sets adding 5-bp degenerate barcode and flanking BsmBI site for the downstream cloning steps ...
-
bioRxiv - Cancer Biology 2022Quote: Plasmids containing AcGFP and LbNOX (Addgene #75285) were gifts from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030; http://n2t.net/addgene:25030;RRID:Addgene_25030) (Tritschler et al. ...
-
bioRxiv - Plant Biology 2019Quote: ... the resulting gRNA plasmids were then recombined with a L1 construct containing pYAO:Cas9_3:E9t39 (kindly provided by Jonathan Jones) and a L1 construct containing Fast-Red selection marker (AddGene #117499) into a L2 binary vector (AddGene #112207).
-
bioRxiv - Plant Biology 2019Quote: ... DNA-oligonucleotides (Figure 2-source data 1) containing the specific gRNA sequence were synthesised and used to amplify the full gRNA from a template plasmid (AddGene #46966). Using Golden Gate cloning40 each gRNA was then recombined in a L1 vector downstream of U6 promoter39 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding phiC31 integrase under control of a heat shock promoter (Addgene #26290) [73]) ...
-
bioRxiv - Developmental Biology 2019Quote: ... using AscI and NotI-containing primers and cloned the fragment into the vector p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMyc[open] (Addgene plasmid #71809). Transgenic lines were generated by Genetivision Inc ...
-
bioRxiv - Cancer Biology 2020Quote: ... a sox10 minimal promoter was PCR amplified from genomic DNA from AB* larvae with primers (Table 1 and 2) containing overlapping nucleotides to sequences on either side of the AgeI site in pENTR-EGFP2 (Addgene #22450), similarly described in (Quillien et al. ...
-
bioRxiv - Immunology 2022Quote: ... Vector psPAX2 containing the untagged coding sequence for HIV-1 gag-pol was a gift from Didier Trono (Addgene plasmid # 12260).
-
bioRxiv - Cell Biology 2021Quote: ... A gBlock containing sequence for SNAP-V5 tags was inserted into pLenti CMVTRE3G eGFP Blast (w818-1) (gift of Eric Campenau, Addgene #27568) at the AgeI restriction site using Gibson Assembly to make pLTRE3G-SNAP-V5-eGFP ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... Site-directed integration into attP sites was achieved by co-injection of an attB-containing vector (400 ng µl-1) and pBS130 (encoding ΦC31 integrase under control of a heat shock promoter (Addgene #26290)60) ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Neuroscience 2021Quote: Rats underwent stereotaxic surgery to inject either an excitatory (AAV8.hSyn.hM3Dq.mCherry; Addgene, catalog # 50474-AAV8) or inhibitory (AAV8.hSyn.hM4Di.mCherry ...
-
bioRxiv - Biophysics 2020Quote: ... Dual transfections containing mCh-Drp1 (Addgene, plasmid #49152) and Mito-GFP (gift from Hari Shroff ...
-
bioRxiv - Systems Biology 2021Quote: ... Sleeping Beauty transposase containing pSB100 vector (Addgene #34879) was a kindly gift of Dr ...
-
bioRxiv - Neuroscience 2020Quote: ... The AAV vector containing floxed ChR2 (Addgene #20297) and floxed eNpHR (Addgene #26966 ...
-
bioRxiv - Genetics 2022Quote: ... Jurkat cells containing pLenti-PE2-BSD (Addgene, #161514) were treated with 10 μg/ml blasticidin for selection of blasticidin and incubated for 72 hours ...
-
bioRxiv - Cell Biology 2021Quote: FRET biosensor containing vectors: pTriEx4-Rac1-2G (Addgene plasmid # 66110 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: pBABE retroviral vector containing GFP-LC3 (Addgene, 22405) was transfected into PT67 cells (ATCC ...
-
bioRxiv - Neuroscience 2022Quote: ... into a pAAV backbone containing stChrimsonR-mRuby2 (RRID:Addgene_105447) and packaged into an AAV (Vigene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Jurkat cells containing pLenti-PE2-BSD (Addgene, #161514) were treated with 10 µg/ml blasticidin for selection of blasticidin and incubated for 72 hours ...
-
bioRxiv - Neuroscience 2023Quote: Plasmids containing pAAV-hsyn-ChrimsonR-tdTomato (Addgene # 59171) (51 ...