Labshake search
Citations for Addgene :
351 - 400 of 829 citations for Protein DNA Interaction Assay since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2019Quote: ... the scaffold DNA sequence was amplified from pDD162 (Peft-3::Cas9 + dpy-10 sgRNA - Addgene plasmid # 47549 ...
-
bioRxiv - Bioengineering 2020Quote: ... We isolated DNA for the HIV gag gene from the pLAIΔmls plasmid (Addgene, plasmid #24594) and cloned the isolated DNA into a pGEM-TEasy plasmid vector (Promega ...
-
bioRxiv - Synthetic Biology 2019Quote: ... synthetic gene fragments from Integrated DNA Technologies (IDT) and the EcoFlex kit (47) from Addgene.
-
bioRxiv - Immunology 2021Quote: ... a pair of complementary DNA oligos was annealed and inserted into pX330 (Addgene plasmid # 42230) (Cong et al. ...
-
bioRxiv - Cell Biology 2021Quote: Guide RNAs were designed as 20 bp DNA oligonucleotides and cloned into pX330 (Addgene 42230), and co-transfected with a circular PQR repair template using Lipofectamine LTX (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Boston University Medical School) with EGFP-Tnrc6a DNA fragment from pT7-EGFP-Tnrc6A (Addgene #25035) plasmid ...
-
bioRxiv - Neuroscience 2022Quote: ... the DNA sequence between aa194 and aa1540 was amplified from V5-GFP-P180 (Addgene #92150), and this fragment was cloned into pEGFP(A206K)-N1 between BamHI and XhoI sites by HiFi DNA assembly ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA encoding SNAPf or H2B-SNAPf was amplified from pSNAPf-H2B control plasmid (Addgene #101124) to generate an insert ...
-
bioRxiv - Biophysics 2023Quote: ... a linear DNA fragment was first amplified by PCR from plasmid pCDW114 (16, Addgene #70061), using primers 5′-GAAGGTCTCCAGCCGTACCAACCAGCGGCTTATC-3′ and 5′-CCGGG TCTCACCATACCCGCTGTCTGAGATTACG-3′ ...
-
bioRxiv - Molecular Biology 2023Quote: ... the DNA fragment encoding APEX2 was PCR amplified from pcDNA5/FRT/TO APEX2-GFP (Addgene) and fused to the N-terminus of DDX3X using fusion PCR ...
-
bioRxiv - Genomics 2024Quote: ... The fragment was subsequently cloned by DNA ligation in the donor vector pEN366 (Addgene #156432), after removal of the TRE3G-CTCF-mRuby2 fragment by digestion using the same restriction enzymes ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293T cells were transfected with the DNA of lentiviral packaging plasmids vSVG (Addgene, USA, #8454), RSV (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293T cells were transfected with the DNA of lentiviral packaging plasmids vSVG (Addgene, USA, #8454), RSV (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... 400ng or “filler DNA” expressing Gal4 (pPK-101) and 100ng of iCre plasmid (Addgene #116755). Nucleofection was performed using the EM-110 nucleofector program ...
-
bioRxiv - Developmental Biology 2022Quote: ... a solution containing two sgRNAs (40 ng/μL each) and Cas9 protein (250 ng/μL) (Addgene; 47327) (Gagnon et al. ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Microbiology 2022Quote: ... with the exception that a 1872 bp region of pLifeAct_mScarlet-i_N1 (Bindels et al., 2017) (26.4 kDa LifeAct-mScarlet protein, Addgene) encompassing the CMV enhancer element ...
-
bioRxiv - Neuroscience 2020Quote: ... The control transmembrane protein PVRL3α was cloned into the mammalian expression vector pCAG-mGFP (Addgene, Cat#14757) to express the protein under the pCAG promoter (pCAG-PVRL3α) ...
-
bioRxiv - Cell Biology 2021Quote: ... hLamp1-BFP (#1016) plasmid encoding BFP-labeled version of human Lamp1 protein was from Addgene (Cat# 98828). GFP-hRab14.dn3 (#1017) ...
-
bioRxiv - Biochemistry 2021Quote: ... Affinity precipitation of other RASSF proteins was done as above for RASSF5 using plasmids provided by Addgene RAS clone collection (RASSF1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... with a modification to include the 717 bp coding sequence for the EGFP protein (Addgene plasmid 26123). The number of genes captured and percentage transcripts of mitochondrial origin ...
-
bioRxiv - Neuroscience 2021Quote: ... retrograde AAV expressing enhanced blue fluorescent protein (EBFP) and Cre recombinase (AAVrg-pmSyn1-EBFP-cre, Addgene #51507) was injected into either NAc or RSC of Rosa26TdTomatoAi9 ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the vectors encoding for the packaging proteins (pCMVR8.74; gift from Didier Trono (Addgene plasmid # 22036; http://n2t.net/addgene:22036; RRID:Addgene_22036)) and VSV-G envelope (pMD2.G ...
-
bioRxiv - Bioengineering 2023Quote: ... ssDNA binding protein and peptide sequences were synthesized and assembled into an AIO plasmid modified from Addgene plasmid #42230 by golden gate cloning ...
-
bioRxiv - Microbiology 2023Quote: ... Plasmids encoding HCoV-229E and SARS-CoV-2 N proteins were obtained from Addgene (#151912 and #141391). C-terminally FLAG-tagged 229E N and SARS-CoV-2 N constructs were cloned into pcDNA3.1 using specific primer sequences (Supplementary Table S1).
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: ... fragments containing promoter and fusion protein segments were digested and cloned into the pKHR4 vector (Addgene #74592) using SpeI (NEB #R3133 ...
-
bioRxiv - Microbiology 2024Quote: ... envelope protein-expressing vector pCMV-VSVG (38) and the transfer vectors pEF1a-CAS9-2A-Blasticidin (#52962, Addgene) or pU6-gRNA-PGK-Puro-2A-BFP encoding CRISPR-Cas9 guide RNAs (gRNAs ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were co-transfected with plasmids encoding a mixture of viral packaging proteins VSV-G (12259, Addgene), viral backbone psPAX2 plasimd (12260 ...
-
bioRxiv - Cancer Biology 2020Quote: For this assay cells were co-transfected with M50 Super 8x TOPFlash (which was a kind gift from Randall Moon, Addgene, Cat #12456) 12 and pRL-TK (Promega ...
-
bioRxiv - Biochemistry 2022Quote: Target plasmids for the selection assays were generated by cloning duplexed oligonucleotides into XbaI and SphI-digested p11-lacY-wtx1 (Addgene ID 69056)16 as previously described7 ...
-
bioRxiv - Molecular Biology 2021Quote: The AAV_Actb HR donor plasmid used for the Cas9-stimulated HR gene targeting assay was a gift from Hui Yang (Addgene plasmid #97317) and consisted of 800bp homology arms targeting the β-actin locus with the P2A-mCherry sequence between the homology arms ...
-
bioRxiv - Evolutionary Biology 2021Quote: Significant results from the MPRA assay of interest were amplified by PCR and cloned into the pLS-mP-Luc vector (Addgene Cat# 106253) in place of GFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... All BY4741 yeast strains used for lifespan assays and for RNA extraction were made prototrophic by transformation with the pHLUM plasmid (Addgene, Watertown, Massachusetts) (Mulleder et al. ...
-
bioRxiv - Genetics 2022Quote: ... in vitro transcription assays for human POU6F2 was performed using a reporter plasmid that encodes DsRed under a Hes5 promoter (Addgene, Cat# 26868). For POU6F2 expression vectors ...
-
bioRxiv - Cell Biology 2023Quote: Vectors for this reporter assay were constructed using a lentiviral construct containing CMV-DsRed and UBC-EGFP on a pHAGE backbone purchased from Addgene (plasmid #24526). This lentiviral construct then underwent site directed mutagenesis using the Agilent QuikChange II kit ...
-
bioRxiv - Cell Biology 2022Quote: ... and TAX1BP1 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GGGGCCACTAGGGACAGGAT) ...
-
bioRxiv - Genomics 2019Quote: ... monomeric streptavidin (mSA) DNA fragments amplified from PCS2+Cas9-mSA plasmid (Cat. 103882, Addgene, Watertown, MA) were inserted into the pY117 plasmid (pcDNA3.1-huMb3Cpf1 ...
-
bioRxiv - Developmental Biology 2020Quote: Mouse YAP cDNAs were isolated by PCR amplification using DNA templates obtained from Addgene (Watertown, MA) and cloned into a shuttle vector at Creative-Biogene (Shirley ...
-
bioRxiv - Synthetic Biology 2021Quote: ... by combining a PCR-amplified FNLS-APOBEC1 DNA from pLenti-TRE3G-FNLS-PGK-Puro (Addgene# 110847), PCR-amplified Cas9n-NG DNA from pX330-SpCas9-NG (Addgene# 117919) ...
-
bioRxiv - Cell Biology 2020Quote: ... The HA-Dre DNA tile was designed based on pCAG-NLS-HA-Dre (Addgene Plasmid #51272).32 The CAG promoter was subcloned from pSF-CAG-Kan (OG505 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA sequences for wildtype and R25C mutant of PHAKT from PH-Akt-GFP plasmid (#51465, Addgene) and PH-Akt(R25C)-GFP plasmid (#51466 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment encoding human 4R1N full length tau were amplified by PCR using tau cDNA (Addgene). And then the DNA fragment encoding 4R1N tau were inserted into the linearized pHR-mCh-Cry2Olig backbone using In-Fusion Cloning Kit (Takara) ...
-
bioRxiv - Cancer Biology 2022Quote: ... a synthesized double-stranded DNA fragment from IDT and inserted into pENTR1A-GFP-N2 (Addgene # 19364) between EcoRI and NotI ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... and ligated into plasmid DNA containing the Cas9 enzyme and a puromycin resistance cassette (PX459, Addgene) followed by exonuclease treatment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the mCherry ORF was amplified from mCherry-H2A-10 (Addgene plasmid# 55054) by PCR using a forward primer harboring EcoR1 site (5’-TGACAGAATTCATGGTGAGCAAGG-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... and β-Actin DNA (Actin mRFP-PAGFP was a gift from Guillaume Charras & Tim Mitchison, RRID:Addgene_62382) into the third-generation lentiviral plasmid pCDH-EF1-IRES-Puro (System Biosciences).