Labshake search
Citations for Addgene :
401 - 450 of 935 citations for Mouse Proto oncogene Mas MAS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Virus (0.25-1 μl) containing either AAV5: hSyn-DIO-hM3Dq-mCherry (excitatory DREADD; Addgene, Watertown MA), AAV5 ...
-
bioRxiv - Cancer Biology 2022Quote: ATR-WT-GFP is a modification of the PCDNA 3.1 ATR-WT plasmid (Addgene, Watertown, MA). A GFP tag was added by Applied Biological Materials (Richmond ...
-
bioRxiv - Neuroscience 2020Quote: ... Two guides RNAs were selected and produced by PCR using the pX330 plasmid (Addgene, Watertown, MA) as a template ...
-
bioRxiv - Cancer Biology 2020Quote: S51A and S51D heIF2α variant in pcDNA3.CD2 expression vectors were obtained from Addgene (Cambridge, MA). Transient transfection of KNS-42 was conducted 24 h post-plating ...
-
bioRxiv - Neuroscience 2019Quote: ... mApple-FTR-940 (F-tractin) was originally from Michael Davidson’s laboratory (plasmid # 54902, Addgene, Cambridge, MA). mApple-paxillin was kindly provided by Dr ...
-
bioRxiv - Microbiology 2020Quote: ... The VSV-G encoding plasmid and lentiviral packaging plasmid psPAX2 were obtained from Addgene (Cambridge, MA). The pLenti-GFP lentiviral reporter plasmid that expresses GFP and luciferase was generously gifted by Fang Li ...
-
bioRxiv - Cell Biology 2021Quote: ... and mEos3.2-LifeAct (no. 54696; a gift from Michael Davidson) were obtained from Addgene (Watertown, MA). 1 µg of plasmid was used to transfect 400,000 cells in each well of a 6-well plate using Lipofectamine 2000 (5 µL ...
-
bioRxiv - Cell Biology 2021Quote: ... and cloned into the BbsI site of pSpCas9(BB)-2A-GFP (pX458; Addgene, Cambridge, MA, USA). PX 458 was a gift from Feng Zhang (Addgene plasmid # 48138 ...
-
bioRxiv - Bioengineering 2022Quote: ... Mammalian expression plasmids pRK5-EGFP-tau and pcDNA3-GSK3b were obtained from Addgene (Watertown, MA, USA). The pRK5-EGFP-tau (# 46904 ...
-
bioRxiv - Genetics 2022Quote: ... which were annealed and cloned into the PUC57-gRNA expression vector (Addgene 51132, Cambridge, MA, USA) with a T7 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... The pAAV-FLEX-tdTomato was a gift from Edward Boyden (Addgene plasmid #28306, Addgene, Watertown, MA).
-
bioRxiv - Genetics 2023Quote: ... Muscle cells were then transfected with a pLenti-myc-GLUT4-mCherry (Addgene; Watertown, MA; stock # 64049) for 48 hours and the GLUT4 localization assay was performed as previously described(Lim ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVrg’s were purchased from Addgene and included either AAVrg-hSyn-Cre-p2A-dTomato (1.5x1013 vg/mL; 107738-AAVrg; Addgene, Watertown, MA), which was used to knockout PTEN ...
-
bioRxiv - Neuroscience 2023Quote: ... The pAAV-FLEX-tdTomato was a gift from Edward Boyden (Addgene plasmid #28306, Addgene, Watertown, MA).
-
bioRxiv - Cancer Biology 2023Quote: CRISPRoff-v2.1 was a gift from Luke Gilbert (Addgene plasmid # 167981;a Addgene, Watertown, MA, USA)9 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Purified ULP1 protease was added to the eluent overnight at 4°C (pFGET19_Ulp1, Addgene, Watertown, MA). The cleaved product was loaded onto a Ni column (Cytvia HisTrap™ High Performance ...
-
bioRxiv - Microbiology 2024Quote: ACE2+ 293 were transiently transfected with pALPS expressing tat-p2a-rev cassette (Addgene, Watertown, MA, USA). The TZM.bl cell were transiently transfected with Wuhan CoV-2 spike expression plasmid pHDM (BEI resources ...
-
bioRxiv - Cell Biology 2024Quote: ... The lentiviral vectors were co-transfected with the packaging vectors pCMV-deltaR8 (Addgene, MA, USA, #12263) and pCMV-VsVg (Addgene ...
-
bioRxiv - Physiology 2023Quote: ... the pAS_4xG1 PylT FLAG-G1 PylRS Y125A tRNA/aminoacyl-tRNA synthetase plasmid (Addgene, Watertown, MA #154773) was used ...
-
bioRxiv - Neuroscience 2023Quote: ... viral prep #50477-AAV8) or eGFP (AAV8-CaMKIIa-EGFP, Addgene, Cambridge, MA, viral prep #50469-AAV8). Craniotomies were created ...
-
bioRxiv - Genetics 2020Quote: Mouse Arid1a gRNA (GCTGCTGCTGATACGAAGGTTGG) was cloned into LentiGuide-puro plasmid (Addgene #53963). LentiCas9-Blast plasmid was purchased from Addgene (Addgene #53962) ...
-
bioRxiv - Cell Biology 2020Quote: ... The mouse HA-Bnip3ΔExon3 (sNip) (Accession #MF156210) were described previously (Addgene #100793) [39] ...
-
bioRxiv - Cancer Biology 2021Quote: A promoter and enhancer element upstream of mouse Fabp4 (from Addgene #8858) was cloned into pAAV-iCre-WPRE (Vector Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... coding sequence of mouse Cry1 and firefly Luciferase in pG5luc plasmid (Addgene) was amplified with primers having EcoRV-NotI and NotI-XhoI flanking sites for Crys and Luc ...
-
bioRxiv - Cell Biology 2020Quote: ... we used a mouse pooled kinome CRISPR-Cas9 pooled library (#75316, Addgene) (23) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the mouse Snai1 gene was amplified from pTK-Snai1 plasmid (#36976, Addgene) using primers (forward ...
-
bioRxiv - Cancer Biology 2023Quote: The mouse Genome-Scale CRISPR Knock-Out (mGeCKO) library A (Addgene #1000000052), composed of ∼68,000 gRNAs ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid encoding the scFv(H2)-Fc(mouse) is available from Addgene; #190691 ...
-
bioRxiv - Developmental Biology 2023Quote: The mouse Runx1 overexpression plasmid pCDNA3.1-Flag-Runx1 was purchased from Addgene. The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene ...
-
bioRxiv - Biochemistry 2023Quote: ... pCMV5 mouse Src was a gift from Joan Brugge & Peter Howley (Addgene plasmid # 13663 ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse PSD95 sequence was a gift from Gary Bassell (Addgene plasmid #102949). TurboID was fused at the C-terminus of PSD95 and inserted into a cre-dependent AAV expression vector under the synapsin promoter by Gibson assembly (NEB) ...
-
bioRxiv - Genomics 2022Quote: ... elegans Vector Kit was a gift from Andrew Fire (Addgene kit # 1000000001). A translational reporter was later generated by synthesizing the remainder of the coding sequence (IDT ...
-
bioRxiv - Cancer Biology 2021Quote: Galectin-3 cDNA was subcloned into the pMIG-GFP retroviral expression vector (plasmid #9044, AddGene, Cambridge, MA). Stably transduced hGalectin-3 expressing OP9 cells were generated by infecting cells with retroviral particles and FACS sorting of GFP expressing (positively transduced ...
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which included ∼19,000 genes with 4 sgRNAs per gene and 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Neuroscience 2021Quote: ... the DNA plasmids were respectively derived from the plasmids pAAV:EF1α:DIO:ChETA-eYFP (plasmid #26968; Addgene, Watertown, MA, USA) and pAAV:EF1α:DIO:eYFP (Addgene plasmid #27056 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Double strands of miR21a-gRNA were synthesised and cloned to LentiCRISPR-V2 plasmid (Addgene, Cambridge, MA, USA) by TsingKe Ltd ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human codon-optimized Streptococcus pyogenes wild type Cas9 (Cas9-2A-GFP) was obtained from Addgene (Cambridge, MA). Chimeric guide RNA expression cassettes with different sgRNAs (sgRNA1 ...
-
bioRxiv - Genetics 2019Quote: ... The wildtype human DYRK1A cDNA was cut from the pMH-SFB-DYRK1A construct (Addgene, Cambridge, MA, USA) and inserted into pCS2-HA vector using XhoI and contains a gateway vector site 5’ to the cDNA ...
-
bioRxiv - Biophysics 2020Quote: ... psPAX2 packaging plasmid (plasmid #12260) and pMD2.G envelope plasmid (plasmid #12259) were from Addgene (Watertown, MA). N-terminally Cy5-labeled peptides were synthesized and purified to > 95% purity by Gen-Script (Piscataway ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The WT human α4 and β1 subunits were subcloned into the pUNIV vector (Addgene, Cambridge, MA, USA) and the human δ-subunit into the pcDNA5/FRT vector (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Cell Biology 2020Quote: ... Whole-genome lentiviral pooled CRISPR/Cas9 knockout library (Cat# 73178-LV) was obtained from Addgene (Cambridge, MA). Alexa FluorTM 568 carboxylic acid succinyl ester ...
-
bioRxiv - Biochemistry 2022Quote: ... cerevisiae eIF6A was purified essentially as described before (45) from the p7XC3GH (Addgene #47066; Watertown, MA, USA) plasmid ...
-
bioRxiv - Bioengineering 2020Quote: ... lentivirus encoding GFP was produced using plasmid for GFP expression (CMV-GFP) purchased from Addgene (Cambridge MA). Transduction was carried out using CMV-GFP lentiviruses in growth media with 8 μg/ml polybrene (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... annealed and cloned at BbsI enzyme restriction site into the px330 modified vector (Addgene, Watertown, MA, USA) (Etoc et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM3D(Gq)-mCherry (Addgene viral prep # 50476-AAV8, Addgene, Cambridge, MA). In the GFP (null virus ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM4D(Gi)-mCherry (Addgene viral prep # 50477-AAV8, Addgene, Cambridge, MA). In the Gq experiment ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1-hSyn1-SIO-stGtACR1-FusionRed and AAV2-hSyn-DIO-mCherry were produced by Addgene (Watertown, MA, USA). All viral vectors were stored in aliquots at −80°C until use.
-
bioRxiv - Cancer Biology 2021Quote: ... H4 human GBM cells were infected with the whole-genome knockout Brunello library (Addgene, Cambridge, MA, USA), which covered ~19,000 genes with 4 sgRNAs per gene along with 10,000 sgRNA non-targeting controls ...
-
bioRxiv - Immunology 2021Quote: ... Sleeping Beauty (SB) transposon plasmid pSBbi-BH23 (a gift from Eric Kowarz; Addgene # 60515, Cambridge, MA, USA) was digested at SfiI sites (NEB ...