Labshake search
Citations for Addgene :
351 - 400 of 935 citations for Mouse Proto oncogene Mas MAS1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and pLKO.1 ShCtrl and psPAX2 (#12260) and pMD2G (#12259) (Addgene, Cambridge, MA, USA) were used ...
-
bioRxiv - Cell Biology 2024Quote: LifeAct-mEmerald (no. 54148) and GCaMP6s (no. 40753) were obtained from Addgene (Watertown, MA). Eevee-ROCK was kindly provided by Dr ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Molecular Biology 2020Quote: Mouse GFP-PGC-1α full length (FL) plasmid (Addgene, #4) was used as template for PCR amplification of a delta C-terminal domain (ΔCTD ...
-
bioRxiv - Cell Biology 2021Quote: The pcDNA 3.1 (-) mouse C/EBPδ expression vector (AddGene, #12559) and annealed oligonucleotides (Supplementary Table S4 ...
-
bioRxiv - Biophysics 2023Quote: ... Mouse TRPM5 in pcDNA3.1 was purchased from Addgene (plasmid #85189), human TRPM5 in pcDNA3.1+ (Accession No ...
-
bioRxiv - Molecular Biology 2023Quote: ... untagged mouse cDNA into a pBig1a vector70 (Addgene, Plasmid #80611). These untagged RING1B and BMI1 constructs were used for all experiments presented in this manuscript with the exception for the data presented in Figure 6C ...
-
bioRxiv - Molecular Biology 2024Quote: Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene#1000000096) was amplified in E coli ...
-
bioRxiv - Cancer Biology 2024Quote: The mouse GeCKO v2 library was obtained from Addgene (#1000000052). LentiCRISPRv2 is a one-vector plasmid system for the mouse GeCKO (Genome-scale CRISPR Knockout ...
-
bioRxiv - Developmental Biology 2021Quote: ... confluent human embryonic kidney (HEK293T) cells were co-transfected with pWPXL (Addgene, Cambridge, MA, USA), and a mixture of packaging helper plasmids (psPAX ...
-
bioRxiv - Neuroscience 2020Quote: ... were co-transfected with the envelope plasmids pRSV-Rev (Addgene, MA, US; Cat. No. 12253), pMDLg/pRRE (Addgene ...
-
bioRxiv - Cancer Biology 2019Quote: Lentiviral particles were produced according to the “pLKO.1 Protocol” provided by Addgene (Cambridge, MA). Briefly ...
-
bioRxiv - Immunology 2019Quote: ... and pcDNA3-N-FLAG-Asc (a gift from Bruce Beutler, #75134, Addgene, Watertown, MA, USA) as templates ...
-
bioRxiv - Genetics 2019Quote: ... The Cas9 cassette was produced by excision from plasmid MLM3613 (Addgene #42251, Watertown, MA, USA) by enzymes SacII and MssI (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 µL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Cell Biology 2020Quote: ... and ligated into digested pspCas9(BB)-2A-puro plasmid (plasmid no. 62988, Addgene, Cambridge, MA). HEK293 cells were suspended in 2 ml of DMEM supplemented with 10% FBS and plated in 6-well plates ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were co-transfected with the packaging vector psPAX2 (#12259, Addgene, Watertown, MA, USA), the envelope vector pMD2.G (#12260 ...
-
bioRxiv - Cancer Biology 2021Quote: GeCKO v2 human library made by Zhangfeng’s lab was purchased from Addgene (Watertown, MA, USA) amplified as described(Joung et al. ...
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 µL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting of SARS-CoV-2 pps ...
-
bioRxiv - Cancer Biology 2020Quote: ... The constitutively active oeSTAT3 lentiviral vector (plasmid #24983) was obtained from Addgene (Cambridge, MA, USA).
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 μL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Neuroscience 2022Quote: ... and 0.5µl of virus (either AAV1-CaMKIIa-ArchT-GFP or AAV8-CaMKIIa-GFP, Addgene, MA) was infused bilaterally with a 1 µl Hamilton syringe into either the PRC (AP ...
-
bioRxiv - Cell Biology 2022Quote: ... pcDNA3.1-hMcl-1 was a gift from Roger Davis (Addgene plasmid 25375, Cambridge, MA, USA) and is indicated in the text as WT Mcl-1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... DREADD mice were injected with AAV9-hSyn-hM3D(Gq)-mCherry (AddGene Plasmid #, Watertown, MA, USA), virus titer 1.8 x 1013 ...
-
bioRxiv - Neuroscience 2023Quote: Most of the AAVs used in this study were obtained from Addgene (Watertown, MA, USA), Stanford University Gene Vector and Virus Core (Stanford ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald-Sec61β (#90992) and Halo-TNFα-RUSH (#166901) were obtained from Addgene (Watertown, MA, USA). All plasmids were confirmed via sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the pCMV-dR8.9 and pCMV-VSV-G plasmids (both obtained from Addgene, Cambridge, MA), using a standard CaCl2-based transfection method(14) ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV5-hSyn-Jaws-KGC-GFP-ER2 (Cat # 65014-AAV5) from Addgene (Watertown, MA, USA).
-
bioRxiv - Neuroscience 2024Quote: ... plus either AAV8-hSyn-DIO-hM4Di-mCherry (2.2 x 1013 GC/mL, Addgene, Watertown, MA) or AAV8-hSyn-DIO-mCherry (Control virus ...
-
bioRxiv - Microbiology 2024Quote: ... To produce lentivirus carrying ACE2 expression cassette 14.2ug of pLENTI-ACE2 (ADDGENE, Watertown, MA, USA), 16ug of pCMVdR 8.2 (ADDGENE ...
-
bioRxiv - Cancer Biology 2024Quote: Stable cell lines were generated by retroviral infection with pBABE-puro (1764, Addgene, Cambridge, MA), pBABE-zeo (1766 ...
-
bioRxiv - Systems Biology 2022Quote: ... and lambda phosphatase were purchased from Addgene (Addgene Kit #1000000094)7.
-
bioRxiv - Genomics 2019Quote: ... from mouse tail genomic DNA and pX330 plasmid (Cat. 42230, Addgene), respectively ...
-
bioRxiv - Cancer Biology 2022Quote: Guides were quantified against the Yusa Mouse V2 library (Addgene #67988) using crisprReadCounts v1.3.1 (https://github.com/cancerit/crisprReadCounts) ...
-
bioRxiv - Neuroscience 2020Quote: ... Mouse nAChR alpha4 CFP was a gift from Henry Lester (Addgene plasmid # 15244 ...
-
bioRxiv - Biochemistry 2021Quote: Mouse Bpnt2 cDNA was cloned into the pBABE-puro (Addgene #1764) retroviral vector using BamHI and SalI restriction sites ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... a mouse KO sgRNA pooled library (Addgene: #1000000096, 10sgRNA per gene) was amplified at 1000X fold coverage ...
-
bioRxiv - Physiology 2020Quote: ... the mouse N-Shh sequence was then cloned in pRRLsin.MND.MCS.WPRE (Addgene) that had been previously digested by NheI and PmlI ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2022Quote: Mouse SEPT6-GFP construct was purchased from Addgene (Addgene plasmid# 38296) and was cloned into the pLVX-IRES-puro vector (Clontech) ...
-
bioRxiv - Immunology 2023Quote: pcDNA3-N-Flag-NLRP3 plasmid encoding mouse NLRP3 (Addgene plasmid # 75127) was a gift from Bruce Beutler61 ...
-
bioRxiv - Molecular Biology 2023Quote: The Mouse Improved Genome-wide Knockout CRISPR Library v2 (Addgene #67988) collection sgRNAs in lentiviral vectors targeting 18 ...
-
bioRxiv - Neuroscience 2022Quote: The majority of the constructs used for expressing aggregating proteins were obtained from Addgene (Watertown, MA). The Addgene catalog numbers are as follows ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids for producing AAV particles for GFP or GCaMP expression were obtained from Addgene (Watertown, MA), including pAAV-CAG-GFP (#37825) ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Genomics 2019Quote: ... monomeric streptavidin (mSA) DNA fragments amplified from PCS2+Cas9-mSA plasmid (Cat. 103882, Addgene, Watertown, MA) were inserted into the pY117 plasmid (pcDNA3.1-huMb3Cpf1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The fragment was inserted into the BsaI site of pMpGE_En03 (Cat. No. 71535, Addgene, Cambridge, MA) to yield pMpGE_En03-MpKNOX1ge ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-Syn-FLEX-GCaMP7f (Dana et al., 2019) (2.8×1013 particles/ml, catalog#: 104492, Addgene, MA) and AAV5-CAG-FLEX-tdTomato (7.8×1012 particles/ml ...