Labshake search
Citations for Addgene :
351 - 400 of 3150 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 Integrase 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: ... gRNA-1 and -2 were cloned into pL-CRISPR.EFS.GFP (Addgene, #57818) and pL-CRISPR.EFS.tRFP (Addgene plasmid #57819) ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... and the sgRNA was ligated into pX330A-1×2 (Addgene, 58766). To construct donor vector ...
-
bioRxiv - Genomics 2022Quote: ... and pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP (Addgene 84151) with slight modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... Univ of Pennsylvania) (Herman et al. 2016) and CaMKII-Cre virus (pENN-AAV9-CaMKII-Cre-SV40; Addgene, Watertown ...
-
bioRxiv - Neuroscience 2021Quote: ... was loaded with the GCaMP6s virus (AAV9.Syn1.GCaMP6s.WPRE.SV40, ≈1.9x1013 GC/ml, Penn Vector Core; RRID: Addgene_100843) and was slowly lowered into VTA (DV -8.1 mm relative to brain surface) ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM3D(Gq)-mCherry (Addgene viral prep # 50476-AAV8, Addgene, Cambridge, MA). In the GFP (null virus ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM4D(Gi)-mCherry (Addgene viral prep # 50477-AAV8, Addgene, Cambridge, MA). In the Gq experiment ...
-
bioRxiv - Molecular Biology 2020Quote: ... These cells were spin transfected for 2h at 1000g with 82*10E6 Brunello virus particles (LentiCRISPRv2, Addgene 73179-LV ...
-
bioRxiv - Neuroscience 2020Quote: A retrogradely-transported adeno-associated virus carrying Cre recombinase (AAV pmSyn1-EBPF-Cre, abbreviated retro-Cre; Addgene viral prep #51507-AAVrg ...
-
bioRxiv - Physiology 2021Quote: ... Cre-positive mice received the AAV-hM4D injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected ∼0.5 μl of retrograde adeno-associated virus expressing tdTomato51 (retroAAV-tdTomato, Addgene Cat# 59462-AAVrg) into the right ACC (bregma +1.2 mm ...
-
bioRxiv - Neuroscience 2020Quote: All optogenetic behavioral manipulations were conducted with bilateral virus injections of AAV2-hSyn-ChR2-EYFP (500nL, Addgene) into either ALM (AP 2.90 ...
-
bioRxiv - Neuroscience 2022Quote: ... we infected the neurons with the retrograde virus pGP-AAVrg-syn-jGCaMP7s-WPRE (Addgene, Plasmid #104487-AAVrg). Injections (450 μL ...
-
bioRxiv - Neuroscience 2022Quote: ... A small volume (0.4 μl total) of virus (AAV8-EF1α-CreOn/FlpOn-GCaMP6f (RRID:Addgene_137122, titer 6.10E+13) for Aldh1a1-iCre/Th-Flpo and VGlut2-IRES-Cre/Th-Flpo mice ...
-
bioRxiv - Neuroscience 2022Quote: ... Cre-positive mice received the AAV-ChR2 injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2022Quote: Tobfl/fl mice were bilaterally injected with Cre-expressing adeno-associated virus AAV1.hSyn.Cre.WPRE.hGH (105553-AAV1, Addgene) to generate hippocampus-specific KO mice ...
-
bioRxiv - Genomics 2022Quote: ... Wild-type (J1) mESCs were transduced with Cas9-blast virus (generated from pLentiCas9-Blast, Addgene ID: 52962) and selected with 10μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Neuroscience 2022Quote: ... DAT-IRES-Cre mice (RRID: IMSR_JAX:027178) were injected with AAV1-CAG-FLEX-GCaMP6f virus (RRID: Addgene_100835). For labelling of SNc Anxa1+ neurons ...
-
bioRxiv - Immunology 2023Quote: ... 0.5 µg of a plasmid encoding the vesicular stomatitis virus G protein (pMD2.G, Addgene plasmid #12259), 0.25 µg of a plasmid encoding for the transactivating protein Rev (pRSV-Rev ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus was generated in HEK293T cells by transfection with the aforementioned transfer vectors and pMDLg (Addgene 12251), pRSV-REV (Addgene 12253) ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 5HT and NPY interneurons in the ACC 200 nl of virus (pAAV-hSyn-DIO-mCherry, Addgene 50459) was injected into the ACC ...
-
bioRxiv - Neuroscience 2023Quote: AAV5.CaMKII.GCaMP6f.WPRE.SV40 was the adeno-associated virus (AAV) used for calcium imaging and was obtained from Addgene at 2.3e13 GC-ml ...
-
bioRxiv - Neuroscience 2023Quote: ... The organoids were transduced with the AAV-hSYN-GFP virus two weeks before DIV70 (Addgene, 105539-AAV1). We dissociated the transduced organoids using papain digestion (Worthington ...
-
bioRxiv - Neuroscience 2023Quote: We injected a conditional GCaMP expressing AAV virus (AAV9:FLEX:GCaMP6s; Addgene Plasmid #:100845; Chen, et al., 2013) in the AOB (Bregma 3.5 ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids encoding the spike glycoprotein of vesicular stomatitis virus (VSV-G) and Cas9 were obtained from Addgene (cat ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Neuroscience 2024Quote: ... The dLight virus (700 nL of AAV5-hSyn-dLight 1.2; Addgene, Watertown, MA; Catalog No.111068-AAV5) was injected unilaterally into the NAc core (in mm ...
-
Formation of a giant unilocular vacuole via macropinocytosis-like process confers anoikis resistancebioRxiv - Cell Biology 2024Quote: ... The cDNAs for GFP-tagged two FYVE domains of mouse HRS and PH domain of human TAPP1 were obtained from Addgene (#140047 and #161985, respectively) and cloned into the pLVX-IRES-puro vector ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Neuroscience 2019Quote: ... double inverted open (DIO)-reading frame adeno-associated virus (AAV): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene; #44362) or AAV5-Ef1a-DIO-Cherry (UNC viral vector core ...