Labshake search
Citations for Addgene :
601 - 650 of 3150 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 Integrase 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... 400nl of a Cre-expressing virus that is retrogradely transported back one synapse (AAV-pmSyn1-EBFP-Cre, titer 1.00 x 1013, Addgene 51507-AAVrg, lot 27021) was injected into external segment of globus pallidus (GPe ...
-
bioRxiv - Neuroscience 2021Quote: Pyramidal cell imaging experiments were performed by injecting a recombinant adeno-associated virus (rAAV) encoding GCaMP6f (rAAV1-Syn-GCaMP6f-WPRE-SV40, Addgene/Penn Vector Core) into male wild-type mice.
-
bioRxiv - Neuroscience 2020Quote: ... A small (~0.5 mm) craniotomy was made and the virus AAV1.hSyn1.mRuby2.GSG.P2A.GCaMP6s.WPRSE.SV40 (Addgene 50942, titer 1.9 × 1013 vg/ml, −50 nL) was injected into the hippocampus (from bregma ...
-
bioRxiv - Neuroscience 2022Quote: ... one group of animals (n=6) received a bilateral injection of a virus driving expression of the calcium indicator GCaMP7s (AAV9-hSyn-GCaMP7s-WPRE; Addgene; 300nL per side) targeting the CA1v at the following stereotaxic coordinates ...
-
bioRxiv - Neuroscience 2022Quote: ... ACS-4500) using Lipofectamine 2000 in FBS free Optimem together with the virus packaging plasmids (psPAX2 and pMD2-G, Addgene # 12260 and # 12259) and the plasmid expressing either wild-type U4atac or an Empty Vector ...
-
bioRxiv - Neuroscience 2023Quote: ... typical dose 6.0×108 gc/mL) and a reporter virus (AAV-PHP-eB_7x-TRE-tdTomato, typical dose 1.8×1011 gc/mL) (Addgene plasmid id: #191210 and, #191207). The viral titers of the tTA virus used were empirically adjusted based on the Cre driver line to yield sparsely labeled brains ...
-
bioRxiv - Developmental Biology 2023Quote: ... a total of 9.45 μg of each library plasmids combined with 6.75 μg lentiviral packaging vector psPAX2 and 1.36 μg vesicular stomatitis virus G (VSV-G) envelope expressing plasmid pMD2.G (Addgene plasmids 12260 and 12259) were transfected with the JetPRIME (VMR ...
-
bioRxiv - Genetics 2023Quote: ... a total of 13.6 μg core enhancer perturbation library plasmids with 5.44 μg lentiviral packaging vector psPAX2 and 1.36 μg vesicular stomatitis virus G (VSV-G) envelope expressing plasmid pMD2.G (Addgene plasmid 12260 and 12259) were transfected with the JetPRIME (VMR ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were first injected with a helper virus (AAV5- hSyn-FLEX-splitTVA-2A-mCherry-2A-B19G; produced in-house, modified after Addgene plasmid no. 52473) into MEC ...
-
bioRxiv - Neuroscience 2024Quote: ... DREADD+ group) was bilaterally injected in the dDG with pAAV5-CaMKIIa-hM4D(Gi)-mCherry (virus titer ≥ 3×1012 vg/ml, Addgene, North Carolina, USA). Inhibitory DREADDs are activated by the artificial ligand clozapine-N-oxide (CNO ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Cell Biology 2022Quote: ... human APC open reading frame purchased from Addgene (#16507), tdmirfp670nano from Max Wilson ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the human ACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Systems Biology 2021Quote: ... we used the human CRISPRi v2 library (Addgene #83969) (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... A pMXs retroviral vector encoding human OCT3/4 (RRID:Addgene_17217), human SOX2 (RRID:Addgene_17218) ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2020Quote: ... The human NKCC1 coding sequence was derived from Addgene plasmid # 49077 ...
-
bioRxiv - Cancer Biology 2022Quote: The human CRISPR activation pooled library Set A (Addgene plasmid #92379 was a gift from David Root and John Doench ...
-
bioRxiv - Microbiology 2020Quote: ... the human hACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Cancer Biology 2021Quote: Wild-type TP53 from both human (Addgene plasmid #69003) or zebrafish (3 days old embryos cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: Human GeCKO v2 library was obtained from Addgene (#1000000048) and amplified according to the provided instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Human CD63 (Addgene plasmid #62964, gift from Paul Luzio) and mScarlet25 (Addgene plasmid #85042 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Cell Biology 2022Quote: ... the Bassik Human CRISPR Knockout Library (Addgene, 101926-101934) is separated into 9 sublibraries comprising a total of 225,171 elements and targeting approximately 20,500 genes (10 sgRNAs per target) ...
-
bioRxiv - Neuroscience 2023Quote: ... under the human synapsin promoter were obtained from Addgene. All viruses were stored at -80°C and aliquots were thawed over wet ice immediately prior to injection.
-
bioRxiv - Microbiology 2023Quote: The human “Brunello” CRISPR knockout pooled library (#73179, Addgene) (Doench et al. ...
-
bioRxiv - Neuroscience 2022Quote: Human CRISPRi sgRNA library Dolcetto Set A17 (Addgene #92385) was transformed into electrocompetent Lucigen Endura™ E ...
-
bioRxiv - Neuroscience 2022Quote: The human Dolcetto CRISPR inhibition pooled library (Addgene #92385), and the plasmids pLX_311-KRAB-dCas9 (Addgene #96918) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human STIM1-CFP plasmid (52) was from Addgene (#19755). CAV1-mEGFP plasmid (53 ...
-
bioRxiv - Molecular Biology 2023Quote: The Human GeCKOv2 CRISPR knockout pooled library19 (Addgene 1000000048), which contains 6 sgRNAs for each gene and 2,000 non-targeting control sgRNAs ...
-
bioRxiv - Immunology 2023Quote: The human genome-wide CRISPRa-V2 library (Addgene 1000000091) was co-transfected with packaging plasmids pCAG-VSVG and psPAX2 (Addgene plasmids 35616 and 12260 ...
-
bioRxiv - Immunology 2023Quote: ... The GeCKO V2 human CRISPR knockout library from Addgene was then introduced into Endura Electrocompetent Cells by means of electroporation using a Bio-Rad Gene Pulser ...
-
bioRxiv - Cancer Biology 2023Quote: The lentiCRISPR v2 GeCKO Human library (Addgene plasmid #52961) was amplified following Sanjana et al. ...
-
Astroglia proliferate upon biogenesis of tunneling nanotubes and clearance of α-synuclein toxicitiesbioRxiv - Cell Biology 2023Quote: The human α-SYN wild-type (Addgene ID #36046) and α-SYN (wt)-141C (Addgene ID #108866 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human LATS1 expression plasmids were obtained from Addgene (41156). Human and murine NLRC5 and CXCL10 promoters were cloned into pGL3 basic luciferase reporter vector (Promega) ...
-
bioRxiv - Cancer Biology 2023Quote: A human kinase domain-focused gRNA library (Addgene 117725) [25] was used to assess CRISPR Cas9 screening as a tool in breast cancer PDTO to identify whether novel vulnerabilities could be detected for each PDTO ...
-
bioRxiv - Neuroscience 2023Quote: ... a human codon optimized FLAG-Cas9 cDNA (Addgene 42230) was modified by C-terminal insertion of an additional nuclear localization signal and a 6-His tag ...
-
bioRxiv - Microbiology 2023Quote: ... human CRISPR Brunello lentiviral pooled libraries (#73179-LV; Addgene) were added to the cell culture at an MOI of 0.25 in the presence of polybrene (Santa Cruz ...
-
bioRxiv - Zoology 2023Quote: ... or a human TLR4 expression clone (Addgene, cat. #13018). Additionally ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Neuroscience 2023Quote: We performed an initial calibrating analysis on Emx-Cre mice (see Animals) expressing Cre-dependent GFP virus (Addgene pCAG-FLEX-EGFP-WPRE; #51502-AAV9) following a dot-wise application of 1:2000 diluted virus (see Organotypic Slice Culture methods) ...
-
bioRxiv - Bioengineering 2023Quote: ... was transfected with 1 µL AAV1-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene viral prep #51085-AAV1, http://n2t.net/addgene:51085, RRID:Addgene 51085, a gift from Jonathan Ting) diluted 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...