Labshake search
Citations for Addgene :
201 - 250 of 3150 citations for Mouse Anti Human Immunodeficiency Virus HIV 1 Integrase 2 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Cell Biology 2023Quote: ... U2OS cells were transduced with virus containing lentiCas9-Blast (Addgene, #52962). Cells were then treated with 5 µg/mL blasticidin for 5 days to make a stable population of U2OS-Cas9 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... or control virus AAV-hSyn-EYFP (AddGene, 50465-AAV2, Watertown MA) into the CeA (−1.17 mm AP ...
-
bioRxiv - Neuroscience 2023Quote: ... and a cre-dependent virus (AAV9-DIO-Ef1a-eYFP, Addgene #27056) were used.
-
bioRxiv - Cell Biology 2023Quote: ... transduced with recombinant adeno-associated virus (rAAV) (Addgene, pAAV TBG FFLuc) supernatant ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mm V) and retrograde AAV-Syn-jGCaMP8f-WPRE virus (Addgene) was injected using a Nanoject ...
-
bioRxiv - Neuroscience 2023Quote: ... retroAAV-CAG-GFP (virus made in the host institute, using Addgene plasmid #37825 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre or GFP expressing adeno-associated virus (GFP pAAV.CMV.PI.EGFP.WPRE.bGH, Addgene 105530; Cre pENN.AAV.CMVs.PI.Cre.rBG, Addgene 105537) were bilaterally injected into the mPFC of AT2R-flox mice at 2.5mm caudal ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were transduced with virus expressing dCas9-VP64 (Addgene, Watertown, MA), selected using blasticidin (6 – 10 µg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequences (sgRNA#1 TTGTTGCCCAGGGTTTAACA and sgRNA#2 CCCATCCCCGGCACCGGGTC) targeting the mouse Nlk locus were cloned into pSpCas9n(BB)-2A-Puro (Addgene #62987; PX462). Cells were transfected with gRNA and Cas9n-expressing plasmids using Lipofectamine 2000 and successfully transfected cells were selected with 3μg ml-1 puromycin for two days ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Neuroscience 2023Quote: ... 1:2 dilution) or AAV5-pCAG-FLEX-EGFP-WPRE (1.1 x 1013 gc/ml, Addgene; 1:2 dilution) was injected in VTA (from bregma ...
-
bioRxiv - Neuroscience 2022Quote: ... or control virus pAAV-CaMKIIa-EGFP (Addgene Cat# 50469-AAV5, titer: 4.3x1012) into the CA2 using the following coordinates from Bregma ...
-
bioRxiv - Neuroscience 2021Quote: ... The control virus (AAV8-hSyn-DIO-mCherry, 2.3×1013 GC/mL, Addgene) was injected according to the same procedure ...
-
bioRxiv - Biochemistry 2021Quote: Tobacco Etch Virus protease (TEV) was a gift from Helena Berglund (Addgene plasmid # 125194 ...
-
bioRxiv - Neuroscience 2022Quote: ... a virus expressing GCaMP6s (AAV9.Syn.GCaMP6s.WPRE.SV40, ~1.9 × 1013 GC/ml; Addgene # 100843) was injected unilaterally in the A13 while for DREADD experiments viruses for reversibly activating (AVV8-Syn-hM3D-Gq-mCherry ...
-
bioRxiv - Neuroscience 2019Quote: ... or AAV5-hDlx-GqDREADD-dTomato (3.15×10^15 virus molecules/mL) (Addgene plasmid # 83897 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1.2 ul of AAV8-hSyn-DIO-hM4D(Gi)-mCherry virus (Addgene, USA) were bilaterally injected into 6 PV-Cre animals bilaterally ±0.5 mm lateral to midline ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.5μl pGP-AAVrg-syn-jGCaMP7f-WPRE virus 25 (1.85× 1013GC/ml; Addgene) was infused into the NAc (A/P ...
-
bioRxiv - Neuroscience 2022Quote: ... the virus used was an AAV5-FLOX-ChR2-mCherry (Addgene, #20297-AAV5) or a AAV5-Ef1a-DIO-eYFP (UNC Vector Core) ...
-
bioRxiv - Immunology 2023Quote: ... Fresh virus of (MSCV-myc-CAR-2A-Thy1.1, Anjana Rao, Addgene: 127890) containing chimeric antigen receptor (CAR ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 or AAV9.syn.GCaMP8s-WPRE virus (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Genetics 2023Quote: Library plasmid pools were packaged into lenti-virus by PsPAX2 (Addgene 12260) and pMD2.G (Addgene 12259 ...
-
bioRxiv - Neuroscience 2023Quote: ... an AAV retrograde virus expressing pAAV-hSyn-hM4D(Gi)-mCherry (Addgene #50475) or pAAV-hSyn-hM3D(Gq)-mCherry (Addgene #50474 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus package plasmids psPAX2 and pMD2.G were purchased from Addgene. To produce the lentivirus ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-CAG-hChR2-tdTomato (virus made in the host institute, using Addgene plasmid #28017 a gift from Karel Svoboda) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-hSyn-eNpHR3.0-EYFP (virus made in the host institute, using Addgene plasmid #26972 ...
-
bioRxiv - Neuroscience 2023Quote: ... stGtACR2-expressingadeno-associated virus(AAV) vector (pAAV_hSyn1-SIO-stGtACR2-FusionRed, Addgene, #105677) stock solution was diluted to 5 × 1011 gc/ml titers ...
-
bioRxiv - Neuroscience 2023Quote: ... Neurons were transduced with the AAV-CamKII-GFP virus (Addgene 50469-AAV9), and neurons with GFP-positive signals were selected for patch clamp experiments.
-
bioRxiv - Neuroscience 2023Quote: ... AAV1-Syn-flex-GCaMP6f (virus made in the host institute, using Addgene plasmid #100833 ...
-
bioRxiv - Developmental Biology 2023Quote: Commercially available sequences for tobacco etch virus protease (TEVp, Addgene Plasmid #8835), tobacco vein mottling virus protease (TVMVp ...
-
bioRxiv - Molecular Biology 2024Quote: ... Hepatitis Delta Virus sequence from the pSVL(D3) plasmid99 (Addgene plasmid #29335) (https://www.addgene.org/29335/) ...
-
bioRxiv - Neuroscience 2024Quote: ... Virus pAAV-hSynapsin1-axon-GCaMP6s-P2A-mRuby3 (Addgene viral prep #1120050-AAV5) was injected into layer 2/3 of the primary somatosensory barrel (S1BF ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 P.1 (Addgene, #170450), SARS-CoV-1 (Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... the adeno-associated virus AAV2/1-Syn-FLEX-mRuby2-CSG-P2A-GCaMP6m-WPRE-SV40 (titer: 2.9 x 1013 GC per ml, Addgene accession no. 102816) in combination with AAV2/1.CamKII0.4.Cre.SV40 (titer ...
-
bioRxiv - Neuroscience 2023Quote: ... or left IC (0.9 mm caudal and 1 mm lateral from lambda suture) to inject 100-200 nL of pAAV-Syn-Chronos-GFP virus (Addgene #59170-AAV1). At the end of the surgery ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse Mln and human REV-ERBα coding sequences were inserted into the pBabe plasmid (Addgene, Cambridge, Massachusetts, USA) by using BamHI-SalII restriction sites ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Genomics 2022Quote: Viral stocks were produced by transfecting either 25 μg of pNL4.3 viral DNA or 45 μg HIV-GKO (Addgene Plasmid#112234) viral DNA together with 10 μg pMD.G packaging plasmid (45 ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... An AAV virus that constitutively expresses eGFP from CMV promoter (Addgene, 105545-AAV9) was used as a cell labeling control (Supplementary Fig ...
-
bioRxiv - Neuroscience 2019Quote: ... A virus lacking the hM4Di DREADD gene (AAV8-CaMKIIa-EGFP, packaged by Addgene) was used as a null virus control ...
-
bioRxiv - Biophysics 2021Quote: The murine stem cell virus (MSCV) backbone was used (similar to AddGene #91975) for retroviral transduction of primary murine T cells ...
-
bioRxiv - Microbiology 2021Quote: ... The virus was produced by transfecting HEK293T cells with plasmid psPAX2 (Addgene; # 12260), plasmid pCMV-VSVG (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... The virus was produced by transfecting HEK293T cells with plasmid psPAX2 (Addgene; # 12260), plasmid pCMV-VSVG (Addgene ...