Labshake search
Citations for Addgene :
401 - 450 of 3085 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: gRNAs targeting LSM14A (5’-TCTGTACCAAAGGATCGAAC-3’) and XRN1 (5’-AGAGAAGAAGTTCGATTTGG-3’) were cloned into LentiCRISPR v2 (Addgene #52961) using BsmBI restriction enzyme sites and confirmed by sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964; http://n2t.net/addgene:104964; RRID:Addgene_104964). AAV2/9 ...
-
bioRxiv - Biophysics 2021Quote: Human ACE2 (hACE2) cDNA was obtained from Addgene (#1786; Watertown, MA, USA). To construct an expression plasmid ...
-
bioRxiv - Cancer Biology 2021Quote: The Human CRISPR knockout Pooled Library (GeCKOv2) was purchased from Addgene (#1000000048) and amplified using E ...
-
bioRxiv - Cancer Biology 2021Quote: ... and then infected with human telomerase reverse transcriptase (hTERT)-containing lentivirus (AddGene) per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-LC3 (human) plasmid construct was purchased from Addgene (catalog number 24920). All mutant ATG9a ...
-
bioRxiv - Cell Biology 2020Quote: Human SAR1 was subcloned into pLenti-puro (Addgene Cambridge, MA; Plasmid #39481). The plasmid containing SAR1 was transfected with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNA encoding human Dnm1 wild-type was amplified from Dnm1-pmCherryN1 (Addgene #27697 ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... pcDNA3-HA-human OCRL (gift from Pietro De Camilli, Addgene plasmid # 22207); pCDNA3.0_mitoLAMA-G97 (gift from Kai Johnsson ...
-
bioRxiv - Cell Biology 2019Quote: Human STAMBPL1 was PCR amplified from FLAG-HA-STAMBPL1 (Addgene plasmid #22559), human TBC1 domain containing kinase (TBCK ...
-
bioRxiv - Cancer Biology 2020Quote: The Brunello CRISPR library targeting the human genome was obtained from Addgene (via John Doench and David Root ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Systems Biology 2021Quote: The human Toronto knockout v3 (TKOv3) genome-scale CRISPR library (Addgene #90294) was used to perform pooled CRISPR knockout screens in Vero E6 ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 13.8μg of Human CRISPR Knockout Pooled Library (GeCKO v2) (Addgene # 1000000049) part A or part B were combined with Lipofectamine 3000 (Thermo Fisher Scientific # L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... Human codon optimized wild-type Mpro was obtained from Addgene (catalog #141370). Mpro single point mutants (M49A ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Developmental Biology 2022Quote: The three conditional lines for transcription factor overexpression (Rosa-A, GA, GAP) were constructed by modifying the Ai3 targeting construct (Addgene #22797; (Madisen, et al., 2010). The EGFP insert in Ai3 was removed by FseI digestion and replaced with coding regions for the following ...
-
bioRxiv - Neuroscience 2020Quote: ... and the helper pAAV2/5 (Addgene #104964), pAAV2/8 (Addgene #112864) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μg pCL-Eco (#12371, Addgene) in Opti-MEM with Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... 5 µg of psPax2 (Addgene, Cat# 12260), and 2 µg of pMD2.G (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg envelope plasmid pMD2.G (Addgene), and 20 µg transfer plasmid (pTRIPZ ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/5 (for AAV5; Addgene plasmid # 104964), or pAAV2/9n (for AAV9 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV2/5-GfAABC1D-hM3Dg-mCherry (Addgene; RRID:Addgene_50478), AAV-CMV-Aldh1a1-shRNA (Stanford ...
-
bioRxiv - Cancer Biology 2020Quote: OE19-dCas9-KRAB stable cells were generated by transfecting 1×106 OE19 cells with 7.5 μg Cas9 plasmid with guides targeting the AAVS1 locus (Addgene #42230; 5’-GGGGCCACTAGGGACAGGAT-3’) and 7.5 μg donor plasmid (pAAVS1-Puro-DNR ...
-
bioRxiv - Neuroscience 2020Quote: T A-QF2-SV40-3xP3-dsRed with QF2 and dsRed open reading frame from ppk301-T2A-QF2 (Addgene plasmid #130667) (Matthews et al. ...
-
bioRxiv - Biophysics 2021Quote: ... and immortalized by transduction with a retrovirus expressing SV40 T antigen from pBABE-puro SV40LT (pBABE-puro SV40LT was a gift from Thomas Roberts (Addgene plasmid # 13970 ...
-
bioRxiv - Neuroscience 2022Quote: ... CMV mScarlet-LC3B (subcloned from EGFP-LC3B, gift from T. Yoshimori, Osaka University, Japan, with mScarlet from Addgene plasmid #85054), CMV EGFP-PPM1H-WT (#DU62939 ...
-
bioRxiv - Biochemistry 2022Quote: Human SERPINE1 cDNA was subcloned from pAY-FE-PAI-1 using ligation independent cloning into the pET Flag TEV LIC cloning vector (2L-T, a gift from Scott Gradia—Addgene plasmid #29175 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pFA6a-link-yoTagRFP-T-Kan (Lee et al., 2013) was a gift from Wendell Lim & Kurt Thorn (Addgene 44906); both were given in the form of bacterial stabs ...
-
bioRxiv - Neuroscience 2023Quote: Th-cre rats were randomly assigned to a viral group and infused bilaterally with a cre-dependent AAV encoding either the inhibitory opsin archaerhodopsin T (ArchT; N = 11; 6 males; AAV5-CAG-FLEX-ArchT-tdTomato, Addgene) or a tdTomato fluorescent protein control (tdTomato ...