Labshake search
Citations for Addgene :
601 - 650 of 3085 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: ... The YTK kit (Addgene; Kit #1000000061) was used as a source for all relevant non-coding DNA sequences — including promoters and terminators ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... for the Right Arm (5’-TACATCCCTAAGGCCTGATTACCCGAACACT-3’, 5’-TATACGCGTTGCCATGCTATTGGCTTC-3’) and cloned into pHD-DsRed-attp (Gratz et al., 2014; Addgene Plasmid # 51019) in two steps ...
-
bioRxiv - Cancer Biology 2019Quote: ... GDI2 (crGDI2-1 Fw 5’ GCCACCCGAGTCAATGGGGA 3’ and crGDI2-2 Fw 5’ CACTCTCTCCTCCGTACGTA 3’) into a lentiviral CAS9 expressing plasmid (Addgene Plasmid # 49535) using the BSMB1 restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCOLN1 was amplified by PCR with the following oligonucleotides with overhangs (underlined): 5’-GACACCGACTCTAGAATGGTGAGCAAGGGCGAGGAGC-3’ (forward) and 5’-AACTAGTCCGGATCCTCAATTCACCAGCAGCGAATGC-3’ (reverse) from Mucolipin1-pEGFP C3 (Addgene plasmid #62960) construct and subcloned into XbaI and BamHI restriction sites of pLenti-CMV-MCS-GFP-SV-puro (Addgene plasmid #73582 ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sgRNA pairs were manually selected from the output list and cloned into the pGECKO backbone (CRISPRi.1: 5’ GTTACTTCCAACGTACCATG 3’, CRISPRi.2: 5’ CCTGTACCCCCATGGTACGT 3’) (Addgene 78534; (68))
-
bioRxiv - Cancer Biology 2021Quote: ... by introducing one or two guide RNAs (5′-GTTGGCTCGCCGGATACGGG-3′ for H3f3b; 5′-ACTCCAGTCTTTCTAGAAGA-3′ for Rosa26) into LentiCRISPR v2 (Addgene plasmid #52961) and LentiCRISPRv2 hygro (Addgene Plasmid #98291) ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Cell Biology 2022Quote: A sgRNA construct targeting exon 2 of the human ACLY gene was made by inserting annealed, phosphorylated oligonucleotides (5′-CACCGGAATCGGTTCAAGTATGCTC-3′, 5′-AAACGAGCATACTTGAACCGATTCC-3′) into pSpCas9(BB)-2A-Puro (PX459, Addgene, plasmid 48139). The sgRNA construct was then transfected (2 μg ...
-
bioRxiv - Systems Biology 2019Quote: ... we performed inverse PCR using F primer (5’-TGAGCGGCCGCTAGGTACCTTTAA-3’) and R primer (5’-GGCACCGGGCTTGCGGGTCATGCA-3’) and pKLV-U6gRNA-EF(BbsI)-PGKpuro2ABFP (Addgene, Plasmid #62348) as a template ...
-
bioRxiv - Microbiology 2020Quote: ... targeting ACE2 (5’-TGGATACATTTGGGCAAGTG −3’) and one targeting B4GALT7 (5’-TGACCTGCTCCCTCTCAACG-3’) was cloned into the lentiGuide-Puro plasmid (Addgene plasmid #52963) following published procedure (Sanjana et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Genetics 2020Quote: ... oligonucleotides for gRNA synthesis (5’ TAGGAGGAAACTGTGCTCTTCA 3’ and 5’ AAACTGAAGAGCACAGTTTCCT 3’) were annealed and ligated into plasmid pDR274 (Addgene #44250, Watertown, MA). Purified plasmid DNA was digested with DraI (New England BioLabs ...
-
bioRxiv - Immunology 2023Quote: ... Next the LentiGuide-Puro plasmid [49] was used to express a single-guide RNA (CD58 sgRNA; 5’-GAGCATTACAACAGCCATCG-3’ and ICAM4 sgRNA: 5’-CCGGGAACACCTGCGTCACG-3’) LentiGuide-Puro (Addgene plasmid # 52963) was a gift from Feng Zhang ...
-
bioRxiv - Molecular Biology 2024Quote: ... The insert containing CGG repeats within the 5’UTR of FMR1 gene fused with EGFP sequence was derived from 5’UTR CGG 99x FMR1-EGFP (Addgene plasmid #63091). The insert was ligated into the vector instead of EGFP sequence ...
-
bioRxiv - Microbiology 2024Quote: The viral 5′UTR reporter constructs were synthesized using GeneArt and cloned into pLV-SARS-CoV-2 5′UTR-Luciferase (Addgene Cat#191480)32 using NdeI and BsaBI ...
-
bioRxiv - Cancer Biology 2019Quote: ... and pLenti PGK GFP Puro (w509-5) (Addgene 19070) were gifts from Eric Campeau & Paul Kaufman ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/5-gfaABC1D-tdTomato was purchased from AddGene (44332).
-
bioRxiv - Neuroscience 2021Quote: ... AAV 2/5 hSyn-GCaMP6f was purchased from Addgene (Cat # 100837-AAV ...
-
bioRxiv - Neuroscience 2021Quote: ... with sgRNA (5’-CTTGTGGGGTCA-TGGTTTACAGG-3’) plasmid (Addgene, 68463), Cas9 plasmid ...
-
bioRxiv - Cell Biology 2021Quote: ... with 5 µg of Cas9-GFP plasmid (Addgene, 44719), 5 µg of sgRNA and 5 µg of ssDNA donor template (Table S1 ...
-
bioRxiv - Cell Biology 2019Quote: ... using vector sequence derived from LV1-5 (Addgene #68411) and cDNAs of SURF4 and Katushka2S (a gift from Gary Luker(100)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5 μg of either H2B-GFP (Addgene #11680) or H2B-RFP (Addgene #26001 ...
-
bioRxiv - Systems Biology 2023Quote: ... The CRISPRi-v2 (5 sgRNA/TSS, Addgene: Cat#83969) sgRNA library was transduced into Jurkat cells at an MOI < 0.3 (BFP+ cell percentages were ∼30%) ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 µg packaging plasmid pUMVC (Addgene, Plasmid #8449). Virus particles were collected 48 h after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... Cre- dependent AAV2/5 hSyn.DIO.hM4D(Gi)-mCherry (Addgene; #44362) expressing the inhibitory hM4Di designer receptor exclusively activated by designer drugs (iDREADD ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Genetics 2023Quote: ... a fli1 P-5’entry clone (Addgene, Lawson Lab), an EGFP p-middle entry (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: 5×NF-κB_RE::RedF (#124530; Addgene, Watertown, MA, USA) is the reporter plasmid consisting of a red firefly luciferase driven by a minimal promoter containing five NF-κB-binding sites (NF-κB-Luc ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 μg envelope helper plasmid (pMD2.G, Addgene #12259) and 80 μl of 1mg/ml polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.0 μl of AAV2/5.CAG.GCaMP6s.WPRE.SV40 (titer: 1X1013; Addgene) was injected into the left trigeminal ganglion (TG ...
-
bioRxiv - Molecular Biology 2021Quote: ... The obtained pGEM-T-RBM8A plasmid was cleaved with Sfi I and subcloned into the Sfi I site of pSBtet-GP vector (Addgene, Watertown, MA, USA) [25].
-
bioRxiv - Molecular Biology 2023Quote: ... WT and T1150A catalytic domains tagged with nuclear localization sequence (NLS) of the SV40 Large T-antigen were cloned into the mVenus-C1 plasmid backbone (provided by Steven Vogel, Addgene plasmids no. 27794) (Koushik et al. ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were immortalized by transduction with a retrovirus expressing SV40 large T antigen from pBABE-puro largeTcDNA (Addgene plasmid # 14088; http://n2t.net/addgene:14088; RRID:Addgene_14088; a gift from William Hahn) as previously described (13) ...
-
bioRxiv - Cell Biology 2020Quote: The Human Brunello library was a gift from David Root and John Doench18 (Addgene #73178). The Toronto human knockout pooled library (TKO ...
-
bioRxiv - Developmental Biology 2020Quote: The histone acetyltransferase domain from human p300 was subcloned from a published construct (Addgene, 61357) (Hilton et al. ...
-
bioRxiv - Cancer Biology 2019Quote: ... Wild-type human CDH1 on a pcDNA3 plasmid was obtained (hE-cadherin-pcDNA3, Addgene, 45769). Variants were generated using the Q5 Site-Directed Mutagenesis Kit (New England Biolabs) ...
-
bioRxiv - Cell Biology 2019Quote: ... which were made by amplifying human Rab1a or Rab5c (Rab1a: Addgene: #46776, Rab5c: GeneArt synthesis) by PCR and inserting the genes in pEGFP-C1 via SacI-KpnI ...
-
bioRxiv - Neuroscience 2019Quote: ... the human TSC1 gene was PCR amplified from a vector containing the hTSC1 cDNA (Addgene) 70 ...
-
bioRxiv - Immunology 2021Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 µL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Bioengineering 2020Quote: ... Full-length human ACE2 was a kind gift from Hyeryun Choe 22 (Addgene plasmid #1786).
-
bioRxiv - Immunology 2021Quote: The full human GeCKOv2 CRISPR knockout pooled library (Addgene #1000000048, a gift from Feng Zhang) was used for genome-wide screening40 ...
-
bioRxiv - Cell Biology 2021Quote: The Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat (Addgene #90294). The library was amplified in bacteria as described in the Moffat protocol on Addgene (https://www.addgene.org/pooled-library/moffat-crispr-knockout-tkov3/) ...
-
bioRxiv - Cell Biology 2021Quote: ... NPC1 human fibroblasts were transfected with either eGFP-Vector or eGFP-HSP70 (Addgene, Cat#15215) plasmid using an Amaxa human dermal fibroblast kit and manufacturer recommended U2OS protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... human MCU gRNA3 (hMCU gRNA1) was subcloned into the lentiCRISPR v2 backbone (Addgene, Plasmid #52961) and transfected into wild-type HEK293 cells via nucleofection as previously described ...
-
bioRxiv - Cancer Biology 2021Quote: GeCKO v2 human library made by Zhangfeng’s lab was purchased from Addgene (Watertown, MA, USA) amplified as described(Joung et al. ...
-
bioRxiv - Microbiology 2021Quote: Human furin was cloned in the sleeping beauty transposon plasmid26 pSB-bi-RP (Addgene #60513), transfected along with transposase ...
-
Sequence and structural variations determining the recruitment of WNK kinases to the KLHL3 E3 ligasebioRxiv - Molecular Biology 2020Quote: ... human KLHL3 (a.a. 298–587) was cloned into the pNIC28-Bsa4 vector (Addgene plasmid #110251), which provides an N-terminal hexahistidine tag as previously described [9] ...