Labshake search
Citations for Addgene :
501 - 550 of 3085 citations for Human Nuclear Factor Of Activated T Cells 5 NFAT5 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... NCBI RefSeq YP_009724397) and inserted by ligation-independent cloning into UC Berkeley Macrolab vector 2B-T (AmpR, N-terminal His6-fusion; Addgene #29666) for expression in E ...
-
bioRxiv - Cell Biology 2023Quote: ... the nucleotide sequence of pEGFP-Mieap between the Nhe I and Xho I restriction sites containing EGFP was replaced with nucleotide sequence of pTagRFP-T-EEA1 (Addgene #42635) between the Nhe I and Xho I restriction sites containing TagRFP-T ...
-
bioRxiv - Biochemistry 2023Quote: ... The PrcA and PrcB genes were sub-cloned in the pET His6 TEV LIC cloning vector (2B-T, a generous gift from the Scott Gardia lab) (Addgene# 29666) and pET His6 TEV LIC cloning vector (2A-T ...
-
bioRxiv - Molecular Biology 2020Quote: ... and for the downstream guide PUS1dnF 5’-CACCGATAACAGCGGTTAGCGGCA -3’ and PUS1dnR 5’-AAACTGCCGCTAACCGCTGTTATC -3’ were phosphorylated and annealed and then cloned into px458 (Addgene) digested with BbsI ...
-
bioRxiv - Developmental Biology 2019Quote: ... Two oligos encoding guide RNA sequences that targeted either exon 3 (5’-GGCTTCGACAAGGCCGAGGG −3’) or exon 4 (5’-GATCTGATCACGACGTGTTA −3’) were inserted into the BbsI site of pU6-BbSI-gRNA (Addgene). Each gRNA construct was independently injected into BDSC Stock 52669 (y1 M{vas-Cas9.S}ZH-2A w1118 ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgRNAs against Luciferase (Luc)(5’-CCCGGCGCCATTCTATCCGC-3’) and USF2 (#2, #3 and #5 as above) were cloned into mCherry-expressing LRCherry2.1 (Addgene #108099) vector.
-
bioRxiv - Neuroscience 2020Quote: ... which was cloned using forward 5’TTGACTGGCGTCATTCGGGA3’ and reverse 5’TCAGGAAGATCTGGGCAAAGAG3’ primers and expressed through the pInducer20 lentiviral vector (Addgene). Western blots were performed using actin as loading control ...
-
bioRxiv - Cell Biology 2020Quote: ... guide RNA (gRNA) targeting TMEM41A (5’-GCCGAGAAGCGGGCGCATGT-3’) and TMEM64 (5’-CCGCGCTGGGCCGAGGCATG-3’) were cloned into pSpCas9(BB)-2A-GFP (Addgene #48138 ...
-
bioRxiv - Neuroscience 2020Quote: ... The entire coding sequence of GCaMP6s was amplified by PCR with primers 5’–GGATCCGCCACCATGGGTTCTCATCATCATCA–3’ and 5’–GTAGCCGAACCGGTCTTCGCTGTCATCATTTGTAC–3’ using pGP-CMV-GCaMP6s (Addgene plasmid # 40753 ...
-
bioRxiv - Neuroscience 2022Quote: ... we generated two independent sgRNA lines that targeted the first and sixth exons (sgRNA1: 5’ GGTGTCTTCATTGGCGCCGCTGG 3’; sgRNA2: 5’ CATTGATGGATTCTACTCCCGGG 3’) and cloned each into the pU63 vector (#49410; Addgene). Constructs were sent to BestGene Inc ...
-
bioRxiv - Immunology 2021Quote: ... were co-electroporated with 5 µg of either pCB92-C*05 or pEx-CAG-KIR2DL1 and 5 µg of pPhiC31o (Addgene) using the Neon transfection system (Thermo Fisher ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNAs targeting RABIF (sg #2: 5’-GAGCGAGTTAGTGTCAGCCGAGG-3’ and sg #4 5’-AGCGAGTTAGTGTCAGCCGAGGG-3’) were cloned in lentiCRISPRv2 (Addgene #52961). MDA-MB-231 cells were infected with the corresponding lentiviruses and selected with 1μg/ml puromycin (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2020Quote: ... the guide RNA targeting HDAC6 exon 5 (5’-GAAAGGACACGCAGCGATCT-3’) was selected and constructed into LentiCRISPRv2 vector (Addgene plasmid 52961). The HDAC6-KO vector can also express the codon-optimized Cas9 protein as well as puromycin resistance gene ...
-
bioRxiv - Molecular Biology 2022Quote: SUGP1 constructs were cloned from pHA-SUGP1 using primers (IB0156 5’-atgacgtcccagactacgcagctagcAGTCTCAAGATGGACAACC-3’; IB0157 5’-tgtttagcgttcagcagcgggatagatccgcctgaGTAGTAAGGCCGTCTGG-3’) into pCDNA3_3xHA-miniTurbo-NLS (Addgene #107172) digested with NheI-HF (NEB #R3131).
-
bioRxiv - Developmental Biology 2023Quote: ... The oligos (5-taggCCTGACAGTACTCACGAC -3’ and 5’-aaacGTCGTGAGTACTGTCAGG -3’) were annealed and ligated into the pT7-gRNA vector (Addgene #46759)(74 ...
-
bioRxiv - Physiology 2023Quote: ... abcc9 gRNA (5’ CATTGCCACGAAGCTGGCGG 3’) or kcnj8 gRNA (5’ ACGCCACTTCAGGTCTACCA 3’) were cloned into BbsI digested plasmid pX330 (Addgene # 42230). T7 sgRNA template and T7 Cas9 template were prepared by PCR amplification and gel purification ...
-
bioRxiv - Cell Biology 2023Quote: ... vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’) and FBXL4 sgRNA-2 (5’-TGGACTACCTCTGCATTGAG-3’) plasmids were cloned into the pLenti-sgRNA (71409; Addgene) vector ...
-
bioRxiv - Immunology 2024Quote: ... targeting CYLD was cloned by annealing two DNA oligos (forward, 5’-GTGGTCAAGGTTTCACTGAC-3’; reverse, 5’-GTCAGTGAAACCTTGACCAC-3’) and ligating into lentiCRISPER v2 (52961, Addgene) plasmids ...
-
bioRxiv - Cell Biology 2023Quote: ... two sequences targeting exon 1 of Numb (5’-GAAAGACGTTTATGTCCCAG-3’ and 5’-GGAAGCTACACTTTCCAGTG-3’) were individually cloned into plasmid pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988). These guide constructs were then electroporated into mESCs using the Lonza Nucleofector 2b Device and Cell Nucleofector Kit (Lonza #VAPH-1001) ...
-
bioRxiv - Cell Biology 2024Quote: ... the primers 5’-CACCGCATCGCTCCTGCGTCCGCCA-3’ and 5’-AAACTGGCGGACGCAGGAGCGATGC-3’ were annealed and subcloned into px458-pSpCas9(BB)-2A-GFP (Addgene) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg pT3 EF1a-MYC (Addgene plasmid # 92046) and 1 μg CMV-SB10 (Addgene plasmid # 24551 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’-entry vector pENTR5’-ubi (ubiquitin promoter) (Addgene plasmid #27230 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 µg VSV-G (pMD2.G, Addgene #12259) and 3.3 µg of plasmid of interest ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Glut2 in pX330S-5 (Plasmid #58781, Addgene). Then ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μl of virus AAV9.CAG.GCaMP6s.WPRE.SV40 (Addgene, USA) was injected intraplantar into the left hind paw using a 10μL Hamilton syringe with a 34G needle attached ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of packaging plasmids psPAX2 (Addgene, #12260) and pCMV-VSV-G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... pMDLg/pRRE (Addgene 658-5, 12259, 12251, 12253) to generate lentiviruses expressing ANDV or TULV N proteins ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5-hSyn-DIO-EGFP (Addgene # 50457-AAV5) or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Cell Biology 2023Quote: ... 5 μg packaging plasmid pUMVC (Addgene, Plasmid #8449), 6.5 μg envelope plasmid pCMV-VSV-G (Addgene ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Bioengineering 2023Quote: ... together with tFucci(CA)5 plasmid29 (Addgene #153521), as per manufacture’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5-FLEX-EGFPL10a was purchased from Addgene. The final titers of these viral vectors were estimated to be 1013 genome copies per milliliter ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of plasmid Δ8.2 (Plasmid #8455, Addgene), and 3 μg of plasmid VSVG (Plasmid #8454 ...
-
bioRxiv - Genomics 2023Quote: ... and 5 μg/flask of psPAX2 (Addgene 12260) using EndoFectin Lenti transfection reagent (GeneCopoeia ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 μg of pVSV-G (Addgene, plasmid # 8454), and 10 μg of the desired plasmid ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The 5’ Entry p5Efli1ep (#31160) purchased from Addgene was originally from Nathan Lawson Lab [56] ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µg of pMDLg/RRE (Addgene plasmid #12251), 5 µg of pRSV/Rev (Addgene plasmid #12253) ...
-
bioRxiv - Biophysics 2024Quote: ... 5 µg of pRSV/Rev (Addgene plasmid #12253), and 3.5 µg of pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μg pCAS9-mCherry-Frame+1 (Addgene #66940), and 5 μg of pCRISPR-HOT_mNEON plasmid (a kind gift from Hans Clevers ...
-
bioRxiv - Cancer Biology 2021Quote: ... The shRNAs targeting HDAC1 (5′-CTATGGTCTCTACCGAAAA-3′) and HDAC3 (5′-GCATTGATGACCAGAGTTA-3′) were cloned into pLKO.1-TRC lentiviral vector (Addgene, #10878). For generation of lentivirus ...
-
bioRxiv - Cell Biology 2019Quote: ... non-targeting (5’-CCTAAGGTTAAGTCGCCCTCG-3’) and DDRGK1-targeting (5’-GGCTCTGCTAGTCGGCTTTAT-3’) shRNAs were cloned into pLKO.1 puro construct (Addgene #8453) according to protocol described in Addgene (https://www.addgene.org/tools/protocols/plko/?gclid=Cj0KCQiAm5viBRD4ARIsADGUT25ZCGNPeQSFvLqSwvg2tHDkCc9zOZsLdaUffZzNTRYzI_YOlKFVQdUaAqbfEALw_wcB)
-
bioRxiv - Microbiology 2019Quote: ... TAAGATCTGTTTAGTGGTGATGGTGATGATGTTTTCCCTTTTGACCTGCGTG EphA2 sgRNA constructs oligos: 5-AAACGTGTGCGCTACTCGGAGCCTC-3 and 5-CACCGGAAGCGCGGCATGGAGCTCC-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). EphA4 sgRNA constructs ...
-
bioRxiv - Microbiology 2019Quote: ... EphA4 sgRNA constructs: oligos 5-AAACCACAGTACATTTTTGGCACAC-3 and 5-CACCGTGTGCCAAAAATGTACTGTG-3 were annealed and ligated into a lentiGuide-Puro plasmid (Addgene, # 52963). Sequencing was performed for all constructs to confirm the correct sequence.
-
bioRxiv - Immunology 2021Quote: ... TPC2(L564P):GCaMP6s and TPC2(L265P/L564P):CaMP6s sequences were amplified (forward primer, 5’-TCCGAATTCAATGGGTTCTCATCATCATCATCATCA-3’, reverse primer, 5’-GATACCGGTTGCAACTTCGCTGTCATCATTTGTACAAAC-3’) and subcloned into mApple N1-vector (Addgene #54567) via EcoRI und AgeI sites.
-
bioRxiv - Neuroscience 2020Quote: ... via the primers 5’ GGAATTCATAGGGCGGCCGGGAA 3’ and 5’ AGCGCTGGCCGGCCGTTTAAAC 3’ and was cloned into plasmid AAV-PGK-Cre (Addgene plasmid # 24593) between the AfeI (NEB ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Genomics 2021Quote: ... two guide RNA sequences (gRNA 5’ TTGGGGGGGCTACTGCCAGC 3’ and 5’ CTTGAACGCCACCCTCTAAC 3’) were cloned into pspCas9(BB)-2A-GFP (Addgene; #48138) and pspCas9(BB)-2A-RFP (Addgene ...
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...