Labshake search
Citations for Addgene :
301 - 342 of 342 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in a sterile 0.9% NaCl solution/plasmid mix containing 10 μg of pT3-MYC (Addgene #92046), 10 μg of pX330-p53 (Addgene 59910) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+) (Addgene, 212205) by restriction-enzyme based cloning and the cHS4-CAG-nlstdTomato-cHS4 and cHS4-CAG-nlsGFP-cHS4constructs ...
-
bioRxiv - Cancer Biology 2021Quote: Mouse Trp53 transcript variant 1 (NM_011640.3) was cloned into the retroviral vector pMSCV-IRES-GFP II (Addgene plasmid #52107). Trp53 point mutations were introduced using site-directed mutagenesis with the Q5 Site-Directed Mutagenesis Kit (New England Biolabs E0552S) ...
-
bioRxiv - Genetics 2020Quote: ... Gibson assembly was used to clone the Vasa-β-globin-II fragment from the Vasa-Cre plasmid (Addgene; 15885) (Gallardo et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gene encoding Cas3/I-G was cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). All the clones were confirmed by Sanger sequencing ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 50 ng/μL Peft-3::cas9 (Addgene ID #46168) (Friedland et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... Brg1L2/L2 mice were injected bilaterally either with a mix of 0.4 μL of pENN.AAV.hSyn.Cre.WPRE.hGH (AAV1, gift from James M Wilson, Addgene #105558, titration 1.1013 vg/mL) and 0.1 μL of pAAV.hSyn.GFP viruses (AAV1 ...
-
bioRxiv - Cell Biology 2021Quote: To generate the nrfl-1(null) deletion allele a mix containing Peft-3::Cas9 (Addgene #46168; 50 ng/μl), two pairs of sgRNA plasmids targeting the 5’ or 3’ ends of the nrfl-1 open reading frame (75 ng/μl each) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells settled to the bottom of the well for 5 minutes at room temperature and then 0.25 μL of F-OKMS lentiviral mix (1:1 of Addgene plasmids 51543 ...
-
bioRxiv - Neuroscience 2023Quote: ... A mix of AAV1-Flex-hSyn1-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA and AAV9-CaMKII-0.4.Cre-SV40 (Addgene, 68720-AAV1 and 105558-AAV9 respectively ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK293T cells at 80% confluence were transfected with a mix of 1.8 μg gag/pol packaging plasmid (Addgene #14887), 0.7 μg pRev packaging plasmid (Addgene #12253) ...
-
bioRxiv - Neuroscience 2020Quote: βII-spectrin-ΔCH-GFP and βII-spectrin-ΔPH-GFP plasmids were modified from FUGW-GFP plasmid (Addgene, 14883, Cambridge, MA). In details ...
-
bioRxiv - Cell Biology 2020Quote: ... we amplified two DNA fragments with PCR and used Gibson assembly to subclone these into the BamHI site of pBluescript II KS+ (Addgene). The first fragment ...
-
bioRxiv - Molecular Biology 2022Quote: ... R179A and R320A were PCR amplified and cloned into pET Strep II co-transformation cloning vector (13S-R, Addgene # 48328). Csb3/I-G was cloned into pQE2 (Qiagen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Sense and antisense riboprobes were designed by subcloning fragments of coding cDNA sequences in pBlueScript II (SK or KS) plasmids (Addgene). Riboprobes were generated by in vitro transcription using the SP6/T7 DIG RNA labelling kit (Roche ...
-
bioRxiv - Immunology 2023Quote: ... Myc overexpression was achieved using the Nucleofector™ II/2b (Amaxa, Koelin, Germany) with pMXs-cMyc plasmid (Addgene plasmids #13375). Naive CD4+ T cells were resuspended in 100μl nucleofector solution (Amaxa ...
-
The haplolethal gene wupA of Drosophila exhibits potential as a target for an X-poisoning gene drivebioRxiv - Genetics 2024Quote: ... attP40{nos-Cas9}/CyO which carries a recessive lethal allele on the second chromosome and cannot be made homozygous) or (ii) a line we generated that has nos-Cas9 (from Addgene plasmid 62208 courtesy of Simon Bullock which has a single NLS and a 3’UTR from nanos ...
-
bioRxiv - Systems Biology 2019Quote: ... the cells were transfected with a mix of 8 µg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library (Addgene #90294) (Hart et al ...
-
bioRxiv - Molecular Biology 2022Quote: The Dux promoter was amplified by PCR with PCR mix (Yeasen, 10149ES03) and then cloned into pGL4.10[luc2] (Addgene, E6651) vector ...
-
bioRxiv - Neuroscience 2023Quote: ... UBA5) were generated as described above with the following modifications: third-generation packaging DNA mix containing pRSV-REV (Addgene #12253), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then LR clonase II reactions were used to shuttle ORFs into pCW-DEST (lentiviral Dox-inducible expression) derived from pCW-Cas9 (Addgene # 50661), and pmax-DEST (transient constitutive expression ...
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Molecular Biology 2022Quote: ... and ΔC (251-545 aa) truncation domains were PCR amplified and cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). The genes encoding Csb1/I-G ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Microbiology 2022Quote: ... insertion of was performed by ClonExpress II One Step Cloning Kit (Vazyme, China) with SpeI-digested pENTR4-FnCas12a and TetR amplicon of plasmid pFREE vector (Addgene, #92050) with the primer pair Tet-F3/Tet-R3 ...
-
bioRxiv - Neuroscience 2022Quote: ... 90ul cells suspension containing 1M cells was mixed with 10 uL DNA mix: 4 ug pSpCas9(BB)-2A-Puro (PX459) plasmid (Addgene #48139), • 0.4 ug gRNA encoding plasmid (pKLV-U6gRNA(BbsI)-PGKzeo2ABFP ...
-
bioRxiv - Bioengineering 2020Quote: ... 1 pmol of the oligo mix was added to a 20 μl Golden Gate reaction containing 100 ng destination plasmid (pATT-DEST, Addgene #79770), 10 units BsaI (NEB #R3733) ...
-
bioRxiv - Systems Biology 2020Quote: ... the cells were transfected with a mix of 8 μg lentiviral lentiCRISPRv2 vector containing the TKOv3 gRNA library 21 (Addgene #90294), 4.8 μg packaging vector psPAX2 ...
-
bioRxiv - Systems Biology 2019Quote: ... 350k HAP1 WT cells were seeded into a 6-well plate and 24 hours later cells were transfected with a mix of 2 µg pX459 plasmid (Addgene #62988) carrying a gRNA ...
-
bioRxiv - Neuroscience 2023Quote: ... the custom library transfection mix was prepared in the following manner: 15 µg of custom library plasmid and 15 µg of third-generation packaging DNA mix containing pRSV-REV (Addgene #12253), pMDLg/pRRE (Addgene #12251) ...
-
bioRxiv - Neuroscience 2023Quote: ... transfection mix for each plasmid was prepared in the following manner: 1 µg of transfer plasmid and 2 µg of second-generation packaging DNA mix containing psPAX (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Genomics 2023Quote: ... PT5 cells were transfected with a plasmid mix containing ZIM3-dCas9-2A-puro-2A-GFP (200ng) and PhiC31 integrase plasmid (pBS130; Addgene, 26290) (200ng) ...
-
bioRxiv - Neuroscience 2024Quote: Adult mice were injected in the barrel cortex with 200nl of AAV mix consisting of pAAV-TRE-DIO-FLPo (Addgene #118027), pAAV-TRE-fDIO-GFP-IRES-tTA (Addgene #118026 ...
-
bioRxiv - Biophysics 2021Quote: Clones of MDCKII expressing GFP-myosin-2-A were created by transfecting cells with pTRA-GFP-NMCH II-A plasmid (Addgene plasmid # 10844). Stable expressing clones were selected via Neomycin resistance (G418) ...
-
bioRxiv - Microbiology 2021Quote: ... vCyclin and vGPCR were amplified by PCR using the cDNA prepared from iSLK.219 as templates and cloned into the Bgl II and EcoR I restriction sites of the pMSCV-puro lentiviral vector (Addgene plasmid # 68469). vFLIP were cloned by inserting its PCR fragment into the modified pMSCV-puro-3HA vector at Bgl II and Xho I restriction sites ...
-
bioRxiv - Cell Biology 2023Quote: ... A pLVX-GFP-MYH9 transfer plasmid was cloned by ligating a NdeI/SalI-digested GFP-MYH9 cassette from CMV-GFP-NMHC II-A (gift from Robert Adelstein, Addgene plasmid #11347) into NdeI/XhoI-digested pLVX-Puro vector ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... Mice were unilaterally injected using a Nanoject II programmable nanoliter injector with 600 nL/hemisphere with AAV5-hSyn-dLight1.2 (Addgene Cat. #111068-AAV5) [33] into the NAc core using stereotaxic bregma-based coordinates ...
-
bioRxiv - Immunology 2024Quote: ... The murine CD3 WTdelta-F2A-gamma-T2A-epsilon-P2A-zeta pMIA II plasmid was a gift from Dario Vignali (Addgene plasmid # 52093) [40] ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1-cell stage embryos were injected with a 1 nl mix of approximately 56-60 pg sgRNA and 190 pg cas9 mRNA (Addgene plasmid #47322). Mosaic embryos were raised to adulthood and crossed with Tupel Long fin (TL ...
-
bioRxiv - Neuroscience 2022Quote: ... GAD2-IRES-Cre mice were injected in the ZI with a 5:1 mix of AAV2/5-hSynapsin1-Flex-axon-GCaMP6s (Addgene, #112010-AAV5) and AAV2/9-FLEX-tdTomato (Addgene ...
-
bioRxiv - Neuroscience 2020Quote: For the control rabies virus experiments VIPCre pups aged P15 were injected with 100nl of a 1:1 mix of pAAV-hSyn-FLEX-TVA-P2A-EGFP-2A-oG (gift from John Naughton, Addgene plasmid # 85225) and rabies virus (see above) ...
-
bioRxiv - Neuroscience 2024Quote: Lhx6-Cre or Lhx6-Cre;Ppargc1aF/Fpups were injected at postnatal day (P)0 or P1 with 600nL of the following viral mix: AAV8-hSyn-dio-hM3D(Gq)-mCherry (Addgene #44361-AAV8) at a 1:40 dilution for sparse cell targeting ...