Labshake search
Citations for Addgene :
251 - 300 of 342 citations for GC TEMPase 2x Master Mix II since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... To chemogenetically activate PVNOT neurons by means of DREADD we employed AAV2/1-DIO-hSYN1-hM3Dq-mCherry (Addgene # 44361; titer: 1.6 × 1013 gc/ml) versus a respective control virus AAV2/1-DIO-hSYN1-mCherry (Addgene # 50459 ...
-
bioRxiv - Neuroscience 2022Quote: ... For injections into the medial entorhinal cortex (MEC) we used AAV2-Retro-Syn-mCherry (titer: 1.9×10e13 GC/ml, Addgene 114472, gift from Karl Diesseroth). To target the superficial MEC ...
-
bioRxiv - Neuroscience 2022Quote: ... A pulled glass pipette attached to a 10μl Hamilton syringe was backfilled with a solution containing a viral construct carrying gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, titer 3×1013 gc/mL Addgene cat no 104488-AAV1). To reach the appropriate titer ...
-
bioRxiv - Molecular Biology 2022Quote: The packaging mix consisting of psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: ... CMV-GFP-NMHC II-B (Addgene plasmids # 11347, 11348)(Wei and Adelstein ...
-
bioRxiv - Cancer Biology 2023Quote: ... (ii) HEK293T with 1.3 μg of psPAX2 (Addgene, #12260), 0.8 μg of pVSVG (Addgene ...
-
bioRxiv - Developmental Biology 2020Quote: ... The 3x FLAG 2x Strep tag sequence was amplified from AAVS1 Puro Tet3G 3xFLAG Twin Strep (Addgene, # 92099) (Dalvai et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... We used Th-cre mice and injected 375nl AAV2/9-CAG-Flex-ChR2-tdTomato into the VTA and infused 450nl AAV9.CamKII.GCaMP6s.WPRE.SV40 (Addgene 107790-AAV9, 2.5 x 10^13 GC/mL) into M2 (Bregma ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.6 mm rostral relative to bregma and at two depths - 0.7 and 0.35 mm from the cortical surface) followed by an injection of pAAV-CAG-Flex-mRuby2-GSG-P2A-GCaMP6s-WPRE-pA (Addgene 68717-AAV1; 1.8×1013 GC/ml) into right motor cortex (1.6 mm lateral ...
-
bioRxiv - Neuroscience 2024Quote: ... Wild-type animals were then injected whether with mix 1 or mix 2 or AAV9-CamKII-GCaMP6f-WPRE-SV40 (Addgene, 100834, vg/mL) or AAV9-CamKII-hM4D(Gi)-mCherry (construct provided by Bryan Roth ...
-
bioRxiv - Neuroscience 2024Quote: ... Co-expression of GCaMP6s and mRuby2 in neocortical and hippocampal neurons was achieved by injecting pAAV-hSyn1-mRuby2-GSG-P2A-GCaMP6s one week before imaging (Fig. 1A; Addgene, catalog # 50942-AAV1; 1.2×1013 GC/mL). Animals were anesthetized using hypothermia ...
-
bioRxiv - Biochemistry 2023Quote: Mass spectrometry sample preparation: N2A cells were transfected with pcDNA3 plasmids containing 2X myc-EXOSC3 or pcDNA3 empty vector (Addgene) using Lipofectamine® 2000 (Thermofisher ...
-
bioRxiv - Neuroscience 2020Quote: ... a mix of pAAV hSyn-Flex RG-cerulean (Addgene 98221) and pAAV-EF1a-FLEX-GT (gift from Edward Callaway ...
-
bioRxiv - Cell Biology 2020Quote: ... into the XhoI site of pBluescript II SK+ (Addgene, Watertown, MA) to create the plasmid pEcoRI_ASalxh.pBSKS.rev ...
-
bioRxiv - Cell Biology 2020Quote: ... Mouse Mannosidase II amino acids 1-116 was amplified from Addgene plasmid #65261 using a forward primer that contains an XbaI site and a reverse primer with an MluI site and further subcloned upstream of the mCherry open reading frame.
-
bioRxiv - Synthetic Biology 2019Quote: A plasmid for SpCas9 expression (2x NLS and C-terminal His tag, pET-28a) was a gift from the Gao group (Addgene #98158).50 E ...
-
bioRxiv - Genetics 2022Quote: ... 2015) flanked by 2X core sequence of the HS4 chicken beta globin insulator was cloned into a targeting vector (Addgene #92142) that contains homology arms of the mouse TIGRE genomic locus (Madisen et al. ...
-
bioRxiv - Immunology 2019Quote: ... The OT1 sequence was cloned from murine TCR OT1-2A.pMIG II (Addgene). The OT1-iR9-iPSC positive clones were further selected by Puromycin (1 μg/ml ...
-
bioRxiv - Cell Biology 2021Quote: Nos regulator elements drive the myosin II RLC (Eric Wieschaus56, Addgene 20163) fused to tdTomato (Michael Davidson ...
-
bioRxiv - Bioengineering 2020Quote: ... or pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) containing the CRMpMHCIIα constructs ...
-
bioRxiv - Plant Biology 2023Quote: ... A neomycin phosphotransferase II (NPTII) cassette (pICH47732::NOSp::NPTII, Addgene no. 51144) was used as selectable marker for plant transformation ...
-
bioRxiv - Neuroscience 2022Quote: ... Synaptophysin-pHluorin (syn-pH) was a gift from Stephen Heinemann and Yongling Zhu (Northwestern University, Evanston, IL; pcDNA3-SypHluorin 2x, Addgene plasmid # 37004). VAMP-mCherry and synaptophysin-GCaMP6f were gifts from Timothy Ryan (Weill Cornell Medicine ...
-
bioRxiv - Bioengineering 2023Quote: Plasmids pab202 and pab633 (gifts from Feng Zhang lab) and pAAV-CMV-dSa-VPR mini.-2X sNRP1 (a gift from George Church; Addgene plasmid # 99688) were used ...
-
bioRxiv - Bioengineering 2021Quote: ... Plasmids mix for each transfection consisted of psPax2 (packaging; Addgene plasmid # 12260), pCMV-SCoV-2S (Spike envelope plasmid ...
-
bioRxiv - Neuroscience 2020Quote: ... a mix of pAAV-EF1a cre off Cer-E2A-RG (Addgene 126471) and pAAV-EF1a-cre off EGFP-2A-TVA (Addgene 126470 ...
-
bioRxiv - Developmental Biology 2020Quote: ... The injection mix contained: 60 ng/µl Peft-3::Cas9 (Addgene #46168), 15 ng/µl repair template ...
-
bioRxiv - Cell Biology 2023Quote: ... with 0.75 μg third-generation lentiviral packaging mix (pMD2.G (Addgene #12259), pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Neuroscience 2024Quote: ... and ii) PCR fragment of FLPo originated from pTCAV-FLEx-FLPo (#67829, Addgene). Because a nuclear localization signal (NLS ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The injection mix was supplemented with 20ng/µl of Cas9-NLS mRNA (Addgene #141108) and 50Cng/μl of Invitrogen Dextran ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:20 of final mix) was mixed with AAV5-hSyn-DIO-mCherry-WPRE (Addgene 50459 ...
-
Contractile acto-myosin network on nuclear envelope remnants positions human chromosomes for mitosisbioRxiv - Cell Biology 2019Quote: ... & MHC-GFP (pT3153, CMV-GFP-NMHC II-A, a gift from Robert Adelstein, AddGene #11347). For transfection of plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... with 3 µg of the episomal plasmid mix (equimolar mixture of plasmids obtained from Addgene: pCE-hOct3/4 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:20 of final mix) was mixed with AAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene 44361 ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... ORC2 sgRNA (GAAGGAGCGAGCGCAGCTTT) was cloned into pCR-Blunt II- TOPO vector backbone (Addgene 41820, Cambridge, MA) using PCR and In-Fusion cloning (Clontech) ...
-
bioRxiv - Cancer Biology 2022Quote: ... HS-SY-II and SYO1 synovial sarcoma cell lines were transduced with lentiCas9-Blast85 (Addgene, #52962) and selected using 20 μg/ml of blasticidin to generate stable Cas9-expressing cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Microbiology 2022Quote: ... This fragment was then inserted into the pLenti-mCherry-Mango II x 24 plasmid (Addgene #127587) digested with Nhe I and BamH I ...
-
bioRxiv - Genetics 2022Quote: ... Transfection mix for each shRNA contained 8.75μg of shRNA targeting construct in pLKO.1 (Addgene#8453), 8.75μg psPAX2 (Addgene#12260 ...
-
bioRxiv - Cancer Biology 2024Quote: ... After 32 hours cells were transfected with an equimolar mix of CK2α/β plasmid (Addgene; #27093) and the relevant MCAM tail variant ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Synthetic Biology 2022Quote: ... was PCR amplified with NEB Q5 High-Fidelity 2X Master Mix (M0492) using primers 1157_onestep_p1 and 1157_onestep_p2. PRExpress (Akmammedov et al. 2017) was obtained from Addgene (122486). The PRE repeats of PRExpress were removed using Kpn-I and Nhe-I and purified using Zymoclean Gel DNA Recovery Kit (Genesee Scientific #11-301) ...
-
bioRxiv - Cell Biology 2020Quote: ... Fragments were purified by agarose gel electrophoresis and individually subcloned into BamHI/NotI-digested pBluescript II KS+ (Addgene). Colonies positive for the plasmid were selected on LB agar with 100 μg/ml ampicillin (Gibco from Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... is based on Addgene 12150770. AAV-sgmir96-Master (Supplementary Fig. 3) is based on pAAV-U6-sgRNA-CMV-GFP (Addgene 85451)71 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The injection mix was prepared in MilliQ H2O and contained 60 ng/mL Peft-3::Cas9 (Addgene #46168), 45 ng/mL each sgRNA plasmid ...
-
bioRxiv - Neuroscience 2019Quote: A 60 nl viral mix containing a 3:1 ratio of AAV2retro-Cre (AAVrg-pmSyn1-EBFP-cre, Addgene) and AAV2-GFP (UNC viral core ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.5 µL of a mix of pAAV-TREtight0mTag-BFP2- B19G (diluted 1:20 in dPBS; Addgene: 100799-AAV1) and pAAV-syn-FLEX-splitTVA-EGFP- tTA (diluted 1:200 in dPBS ...
-
bioRxiv - Neuroscience 2024Quote: ... with 600 nL of a viral mix composed of AAV8-hSyn-dio-hM4D(Gi)-mCherry (Addgene #44362-AAV8) at a 1:40 dilution for sparse cell targeting and AAV8-hSyn-dio-GFP (Addgene #50457-AAV8 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resuspended in a sterile 0.9% NaCl solution/plasmid mix containing 10 μg of pT3-MYC (Addgene #92046), 10 μg of pX330-p53 (Addgene 59910) ...