Labshake search
Citations for Addgene :
101 - 150 of 191 citations for Chromosome 11 Open Reading Frame 53 C11ORF53 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids as described previously.11 pLKO.1-Scrambled plasmids (Addgene, #136035) were used as negative control ...
-
bioRxiv - Plant Biology 2021Quote: ... IPT3 promoter was cloned in frame with a nuclear localization signal (Addgene, catalog number: 50294), tdTOMATO CDS ...
-
bioRxiv - Molecular Biology 2023Quote: ... The inserts were first cloned in frame into a pCS2+8CmCherry vector (Addgene Plasmid #34935) using AscI (NEB #R0558 ...
-
bioRxiv - Immunology 2023Quote: ... Gatad2b (5’-CGTCTAGCACTCATATCCAC-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) V2.0 (53) (Addgene plasmid #62988). SgRNAs for CRISPR silencing (sgRipk3 enhP #1 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... coli chromosome at the λ integration site by electroporating this plasmid into DH10B cells containing the helper plasmid pInt-ts (Addgene #66076) and selecting for kanamycin resistant colonies ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The expression of Biotin ligase BirA from pTP264 (Addgene #149334) was carried out as described before (Pleiner et al. ...
-
bioRxiv - Biophysics 2023Quote: ... coli biotin ligase BirA from the T7 promoter (Addgene#109424) in E ...
-
bioRxiv - Cell Biology 2022Quote: ... followed in frame with coding sequence for LacI-NLS (sequence taken from “Cherry-LacRep”; plasmid #18985; Addgene). This sequence was subcloned in the pCDH-EF1-CymR-T2A-Puro (QM200VA-1 ...
-
bioRxiv - Plant Biology 2019Quote: ... Plasmid pN_35S/CTP-mCitrine was produced in an earlier study [41] and encodes an mCitrine fluorescent protein fused in-frame to the chloroplast transit peptide from RuBisCO small subunit 1A (www.addgene.org, plasmid #117989 (RRID:Addgene_117989)) ...
-
bioRxiv - Microbiology 2021Quote: ... marinum genomic DNA and cloned in-frame into the SspI site of 6XHis-MBP-TEV (AddGene: 29656). Plasmids were freshly transformed into the E ...
-
bioRxiv - Developmental Biology 2022Quote: ... Isolated cDNAs were cloned in-frame with the V5 tag into the pMT-V5-HisB vector (Addgene) using the conventional restriction digestion and ligation method ...
-
bioRxiv - Neuroscience 2019Quote: ... and fusing it (in-frame) to the end of coding region for eGFP in (Addgene 60058, pOTTC407) using ligation-independent cloning (AAV-empty ...
-
bioRxiv - Developmental Biology 2019Quote: ... using AscI and NotI-containing primers and cloned the fragment into the vector p-attB-min.hsp70P-FRT-STOP#1-FRT-DamMyc[open] (Addgene plasmid #71809). Transgenic lines were generated by Genetivision Inc ...
-
bioRxiv - Developmental Biology 2020Quote: ... The expression vector pCAG-mNG2(11) were derived from pCAG-ERT2CreERT2 (Addgene #13777) (Matsuda and Cepko ...
-
bioRxiv - Systems Biology 2019Quote: All pDONR221 Gateway donors were cloned into the Gateway destination vector pAG416GAL-ccdb-EYFP[53] (CEN, URA3, AmpR, referred to as pAG416) obtained from Addgene via the LR reaction ...
-
bioRxiv - Synthetic Biology 2022Quote: We generated a plasmid expressing the translationally fused protein TfR-sfGFP-SpyCatcher003-sfCherry1-10 (InterCatch-GFP) by inserting sfCherry1-10 gene sequence from pcDNA3.1(+)_SpyCatcher-6aa-sfCherry1-10 (Feng et al. [53], Addgene #117484) into the TfR-sfGFP-myc tag-SpyCatcher003 plasmid (Keeble et al ...
-
bioRxiv - Genetics 2021Quote: ... and fused in frame with the human ZNF10 KRAB domain (amplified from the pAAVS1-NDi-CRISPRi (Addgene #73498)) or the catalytic domain (CD ...
-
bioRxiv - Cancer Biology 2023Quote: ... or Notum (Gateway ORF clone ID #164485821) was clonned in frame under 7xTCF promoter (7TGC; Addgene plasmid #24304) upstream of EGFP sequence using In-Fusion HD cloning kit according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... the sequences described above were cloned in frame with the signal peptide NLS (in plasmid pICH86988; Addgene (www.addgene.org) # 48076 ...
-
bioRxiv - Plant Biology 2019Quote: ... thaliana accession Columbia as well as eYFP from pBlunt-EYFP-TAG 52 and mRuby2 CDS from pcDNA3-mRuby2 53(plasmid #40260; Addgene, www.addgene.com) were PCR amplified ...
-
bioRxiv - Genetics 2022Quote: ... Enhancer reporters were produced by fusing via PCR stitching these constructs to a pes-10 minimal promoter::HIS-24::mCherry::let-858 3’UTR fragment amplified from the POPTOP plasmid [53] (Addgene #34848). The enhancer reporters were purified with a PureLink PCR purification kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... and AP5Z1 cDNA was transferred by LR clonase into the pDest-53 or the pDEST-CMV-N-Tandem-mCherry-EGFP vector (Addgene #123216), respectively ...
-
bioRxiv - Developmental Biology 2022Quote: Guide RNAs were designed to target genes and co-electroporated with pCI-Cas9-Citrine (Addgene #92358. For more detail see (53).
-
bioRxiv - Neuroscience 2020Quote: ... Dphox and phox vectors were C-terminally tagged with GFP by infusion cloning in frame into CAG-GFP (Addgene) using the following primers ...
-
bioRxiv - Microbiology 2021Quote: ... was assembled in-frame with a hygromycin resistance gene into pHR-PGK (a gift from Wendell Lim, Addgene #7912093), generating pHR-PGK-dCas9-SunTag-P2A-HygR.
-
bioRxiv - Immunology 2020Quote: The targeting constructs used for introducing the in-frame mAID sequences into mouse endogenous CTCF locus (pEN84, Addgene #86230) and for introducing the OsTir1-V5 expression cassette into endogenous Rosa26 locus (pEN114 ...
-
Epigenetic Interaction between UTX and DNMT1 Regulates Diet-Induced Myogenic Remodeling in Brown FatbioRxiv - Physiology 2020Quote: ... full-length Prdm16 overexpressing plasmid with an in-frame N-terminal FLAG tag was purchased from Addgene (Addgene #15504). Full-length Dnmt1 cDNA clone was obtained from Open Biosystems and further subcloned into the pLVX lentiviral expression vector (Clontech ...
-
bioRxiv - Developmental Biology 2023Quote: ... was cloned with Gibson assembly in frame with the SV40pA sequences that were PCR amplified from lentiCRIPSRv2 (Addgene, #52961). Gibson cloning was subsequently used to simultaneously encompass digested 8xtetO-EF1a promoter-eGFP-SV40pA cassette in frame with the homology arms and the whole insert was cloned into the pSMART-HCKAN (Lucigen ...
-
bioRxiv - Microbiology 2023Quote: ... Pmyo-3::mCherry] by cloning 1397bp promoter and 1266bp coding sequence of col-51 in frame with GFP into the vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene) and microinjecting to N2 worms.
-
bioRxiv - Biophysics 2022Quote: ... and pET21a-BirA (Biotin Ligase) was a gift from Alice Ting (Addgene plasmid # 20857 ...
-
bioRxiv - Microbiology 2019Quote: ... the pSLC recombineering series (11) which was a gift from Swaine Chen (Addgene plasmid # 73194), pON.mCherry (21 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pSFFV_mNG2(11)1-10 plasmid was a gift from Bo Huang (Addgene plasmid # 82610) (Feng et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 250μl per site at an 11-degree angle) with AAV5-EF1α-DIO-ChR2-eYFP (Addgene) to selectively target neuronal populations expressing Cre ...
-
bioRxiv - Microbiology 2019Quote: ... full length VPA0226 was amplified using primers 3’ GATC AGATCT ATGATGAAAAAAACAATCACACTA 5’ and 5’ GATA GAATTC G GAAACGGTACTCGGCTAAGTTGTT 3’ and cloned in frame with GFP into the expression vector sfGFP-N1 (41) (Addgene) between BglII and EcoRI sites for the expression of C terminally tagged VPA0226 ...
-
bioRxiv - Molecular Biology 2019Quote: Human p531-393 in pGEX-2TK (Ampicillin) coding for an in-frame N-terminal GST tag was a gift from Cheryl Arrowsmith (Addgene plasmid # 24860 ...
-
bioRxiv - Genetics 2020Quote: ... the reporter construct was made by cloning the sequence for Renilla luciferase and SARS-CoV-2 frameshift signal in the 0 frame upstream of the firefly luciferase sequence in the pISO plasmid (Addgene), with firefly luciferase in the −1 frame ...
-
bioRxiv - Biochemistry 2021Quote: ... Vector pREXNH3CA used to clone EfrCD in frame with a C-terminal Avi-tag was constructed from pREXNH3 (Addgene #47079) by PCR amplification with 5’ phosphorylated primers pREXNH3(newAvi_5’P)_FW (5’-aga aaa tcg aat ggc acg aaT AAT AAC TAG AGA GCT CAA GCT TTC TTT GA ...
-
bioRxiv - Immunology 2020Quote: ... and the full-length protein (IFT20, aa 1-132) in-frame with the tags into the pEGFP-N1 (#6085-1 Addgene) and pGEX-6P-2 vectors (#27-4598-01Addgene) ...
-
bioRxiv - Biophysics 2019Quote: ... the in-frame GFP fusion from pUAST-GFP-Clc [3] was excised with an EcoRI/BglII digest and replaced with mEmerald (Addgene), PCR amplified with primers GGAATTCCACCATGGTGAGCAAGGGCGAGG and CGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG (the EcoRI and BglII sites in the primers are underlined) ...
-
bioRxiv - Neuroscience 2022Quote: ... and fused in frame without a linker to human H2B (H2BC11) (accession #NM_021058) and cloned into the pAAV-CAG-tdTomato (Addgene #59462) using the sites KpnI and EcoRI at the 5 and 3 prime end respectively ...
-
bioRxiv - Neuroscience 2024Quote: ... was cloned in-frame to the N-terminal domain of the mouse NFL gene (derived from pmNFL; Addgene ID 83127) using the NEBuilder HiFi DNA Assembly cloning kit (New England Biolabs E5520S) ...
-
bioRxiv - Genomics 2019Quote: ... two different sequences targeting Denr were cloned into pLKO.1puro backbone vector (Addgene no. 10878 (11)) ...
-
bioRxiv - Molecular Biology 2023Quote: pDF0159 pCMV - huDisCas7-11 mammalian expression plasmid was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid #172507 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Lenti-EF1α-VP64-dCas9-VP64_Blast was generated by inserting VP64 in-frame right after the ATG start codon of lenti dCAS-VP64_Blast (Addgene plasmid #61425). Similarly ...
-
bioRxiv - Genomics 2020Quote: ... The INTS6 ORF was PCR amplified with 5’ Xho I and 3’ EcoRI restriction site overhangs and the coding sequence for a C-terminal V5 epitope tag was added in frame to the 3’ end of the INTS6 ORF (Key Resources Table. The INTS6 PCR product and MSCVpuro vector (Addgene 68469) were digested with XhoI (NEB R0146 ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids for the FRET-based aggregation reporter were constructed by cloning a fusion of the K18 repeat domain of tau containing the P301L/V337M mutation (20) in frame with C-terminal Clover2 (Addgene #54711) or mRuby2 (Addgene #54768 ...
-
bioRxiv - Bioengineering 2021Quote: The gene encoding yqjM was cloned under the T7 promoter in-frame with an N-terminal 6x HisTag of the p15TvL expression vector (AddGene: 26093) using the In-Fusion@HD EcoDry kit ...
-
bioRxiv - Plant Biology 2021Quote: ... 2013) comprising overhangs was synthesized by Synbio Technologies and cloned in frame with a nuclear localization signal (Addgene, catalog number: 50294), turbo GFP (Addgene ...
-
bioRxiv - Developmental Biology 2022Quote: ... The fragment was cloned via BamHI and EcoRI in frame into expression plasmid XLT.GFPLT-CS2+ (gift from Randall Moon; Addgene plasmid # 17098). The integrity and functionality of the construct was verified by sequencing ...