Labshake search
Citations for Addgene :
1 - 50 of 191 citations for Chromosome 11 Open Reading Frame 53 C11ORF53 Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... The hACE2 open reading frame (Addgene# 1786) was cloned into a 3rd generation lentiviral expression vector pRRLSIN.cPPT.PGK-GFP.WPRE (Addgene# 122053) ...
-
bioRxiv - Cell Biology 2022Quote: ... human APC open reading frame purchased from Addgene (#16507), tdmirfp670nano from Max Wilson ...
-
bioRxiv - Neuroscience 2020Quote: 3xP3-eYFP-SV40 with YFP open reading frame from Addgene plasmid #62291 (Primers ...
-
bioRxiv - Neuroscience 2022Quote: ... ASD-risk genes open reading frames (ORFs) were purchased from Addgene and Genscript or amplified from human adult and fetal brain RNA (Takara ...
-
bioRxiv - Neuroscience 2022Quote: ... double inverted open (DIO)-reading frame AAV2-hSyn-DIO- mCherry (Addgene; #50459) diluted to 1.5×1011 viral particle/mL for neuronal morphology 24.
-
bioRxiv - Molecular Biology 2023Quote: ... The fluorescent reporter open-reading frames (S3 table) were ordered from Addgene and cloned into the accepting vectors utilizing PCR and Gibson assembly ...
-
bioRxiv - Biochemistry 2023Quote: We amplified the open reading frame encoding APEX2 from APEX2-NLS plasmid (Addgene plasmid #49386 ...
-
bioRxiv - Genetics 2023Quote: ... the open reading frame was cloned into a piggyBac vector backbone (Addgene #133568) and expressed from a CAG promoter ...
-
bioRxiv - Biophysics 2021Quote: ... The dCas9 open reading frame used in all dCas9-based constructs originates from Addgene plasmid #60910 ...
-
bioRxiv - Systems Biology 2020Quote: ... we replaced the SpCas9 open reading frame (ORF) in pLentiCRISPRv2-puro (Addgene plasmid # 98290) plasmid with an enhance green fluorescence protein (EGFP ...
-
bioRxiv - Neuroscience 2021Quote: ... The Htt97-EGFP construct was generated by subcloning the open reading frame from Addgene #1186 into FhSynW.
-
bioRxiv - Neuroscience 2023Quote: ... The open reading frame of PE2 was extracted from pCMV-PE2 (Addgene plasmid #132775) by PCR with primers (prRR842 and prRR849) ...
-
bioRxiv - Cancer Biology 2023Quote: The LIG1 open reading frame (ORF) was amplified by PCR from pDONR223_LIG1_WT_V5 (Addgene, 83006) and cloned into the pOZ-FH-C vector ...
-
bioRxiv - Genetics 2023Quote: ... we inserted the resulting ddCas12a-[Repr] open reading frame in-frame with P2A-BFP in a piggyBac vector (Addgene #133568) to enable direct comparison with other fusion protein constructs cloned in the same vector backbone (crRNA’s are encoded on separate plasmids as described below).
-
bioRxiv - Molecular Biology 2020Quote: ... open reading frames were cloned into pLenti CMV GFP Neo/Blast/Puro (Addgene 17447, 17445, 17448). Constructs were transfected into 293FT cells together with psPAX2 (Addgene 12260 ...
-
bioRxiv - Microbiology 2020Quote: ... were constructed by replacing the Redβ open reading frame (ORF) of pORTMAGE311B plasmid (Addgene accession: 120418)43 with PapRecT and CspRecT respectively ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Genetics 2023Quote: ... UASp-dCas:HA:Turbo:NLS was made by combining the dCas9 open reading frame from SID3s-dCas9-KRAB (RRID:Addgene_106399) with HA:TurboID:NLS in the pUASpattB vector (RRID:DGRC_1358) ...
-
bioRxiv - Molecular Biology 2022Quote: The GNB1L open reading frame (ORF) was inserted into the pLVU/GFP lentiviral plasmid vector (Addgene, 24177) encoding a C-terminal GFP tag ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmid pAAV-FLEX-GCaMP6s was created by inserting the GCaMP6s open reading frame from pCMV-GCaMP6s (Addgene plasmid 40753 ...
-
bioRxiv - Genomics 2022Quote: ... Lipa open reading frame (NM_001111100) was cloned into the AscI site of the backbone vector (Addgene, #74285)24 for the final construct ...
-
bioRxiv - Microbiology 2022Quote: ... The open reading frames of the HAs of A/Vietnam/1203/2004 H5 (Addgene plasmid #182546, [35]), A/Puerto-Rico/8/1934 H1 [39] ...
-
bioRxiv - Cancer Biology 2019Quote: ... DNp63α or GFP open reading frame (ORF) was cloned into pLEX_306 (a gift from David Root, Addgene #41391), pLEX_307 (a gift from David Root ...
-
bioRxiv - Neuroscience 2019Quote: ... double inverted open (DIO)-reading frame adeno-associated virus (AAV): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene; #44362) or AAV5-Ef1a-DIO-Cherry (UNC viral vector core ...
-
bioRxiv - Genomics 2023Quote: ... was used to amplify all of the open reading frames (ORFs) from their original vectors (Addgene or ORFeome) in order to add attB sites ...
-
bioRxiv - Cell Biology 2021Quote: ... the open reading frames of mTagBFP2 and mNeongreen2 were amplified by PCR from donor vectors pBAD-mTagBFP2 (Addgene #34632) and pSFFV_mNG2(11)1-10 (Addgene #82610) ...
-
bioRxiv - Neuroscience 2020Quote: T2A-QF2-SV40-3xP3-dsRed with QF2 and dsRed open reading frame from ppk301-T2A-QF2 (Addgene plasmid #130667) (Matthews et al. ...
-
bioRxiv - Neuroscience 2020Quote: T2A-QF2-SV40-3xP3-dsRed with QF2 and dsRed open reading frame from ppk301-T2A-QF2 (Addgene plasmid #130667) (Matthews et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... L-Myc or LacZ open reading frame (ORF) was cloned into pLEX_307 (a gift from David Root, Addgene #41392) using the Gateway® cloning methods according to manufacturer’s recommendations ...
-
bioRxiv - Genetics 2021Quote: ... The pMPRAdonor2-eGFP plasmid was created by cloning the eGFP open reading frame into the pMPRAdonor2 plasmid (Addgene #49353) digested with NcoI and XbaI restriction enzymes ...
-
bioRxiv - Neuroscience 2022Quote: ... chr.14 5’-AAGAAAGAAACTTGGCATAG-CAG 14:56,271,668-56,271,690) was assessed in transfected HeLa cells using TurboRFP open reading frame reconstitution reporter plasmid (pAR-TurboRFP; Addgene #60021) as described previously (Kasparek et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... was made similarly but with the tricistronic open reading frame from pAAV-syn-FLEX-splitTVA-EGFP-tTA (Addgene 100798) except for the use of FRT sites instead of lox ones (and with a 2-bp frameshift of the in-frame FRT site to prevent creation of a premature stop codon) ...
-
bioRxiv - Cancer Biology 2024Quote: The full-length human HK2 open reading frame (ORF) flanked by the linkers was amplified by PCR using plasmid FLHKII-pGFPN3 (RRID:Addgene_21920) as a template with primers (GGGTCCTGGTTCGATGATTGCCTCGCATCTGCTTGCCTACTTC and CTTGTTCGTGCTGTTTACTATCGCTGTCCAGCCTCACGGATGCGGC ...
-
bioRxiv - Neuroscience 2022Quote: ... Err2EnR was generated by fusing the open reading frame of the transcriptional repressor domain of Drosophila Engrailed (amplified from CAG-EnR plasmid, Addgene plasmid #19715 ...
-
bioRxiv - Neuroscience 2020Quote: T A-QF2-SV40-3xP3-dsRed with QF2 and dsRed open reading frame from ppk301-T2A-QF2 (Addgene plasmid #130667) (Matthews et al. ...
-
bioRxiv - Pathology 2022Quote: ... which enabled the insertion of all other alternative effector domains including D3A (amplified open reading frame, ORF, from Addgene #66819), D3B (amplified ORF from Addgene #66820) ...
-
bioRxiv - Cell Biology 2020Quote: ... the TUB1 or tub1G437R open reading frames from the respective pCR2 vectors (see above) were cloned into the pLexA vector (Addgene) to produce LexADBD-Tub1 (or LexADBD-Tub1G437R ...
-
bioRxiv - Neuroscience 2022Quote: ... the NheI – BsrGI fragment containing SFL in the pcDNA3.1/CAG vector was ligated into the corresponding RE sites of an AAV2 vector with the elongation factor 1α promoter and double-floxed inverted open reading frame (EF1a-DIO; a gift from Karl Deisseroth; Addgene plasmid #: 55631; RRID: Addgene_55631) in the untranslatable reverse orientation ...
-
bioRxiv - Neuroscience 2022Quote: Cre-dependent mt-GFP and mt-GCaMP6f AAV plasmids was created by replacing the mCherry open reading frame (ORF) in pAAV-EF1a-mCherry-DIO (Addgene plasmid #20299, RRID: Addgene_20299) with mt-GFP or 4mt-GCaMP6f (‘mt-GcAMP6f’ in the main text) ...
-
bioRxiv - Neuroscience 2023Quote: ... was generated by inserting the GCaMP6s open reading frame from pGP-CMV-GCaMP6s (Addgene plasmid 40753, gift of Douglas Kim) [64] into the pAAV-hSyn-DIO-hM3Dq-mCherry backbone ...
-
bioRxiv - Genetics 2023Quote: The denAsCas12a open reading frame was PCR amplified from pCAG-denAsCas12a(E174R/S542R/K548R/D908A)-NLS(nuc)-3xHA-VPR (RTW776) (Addgene plasmid # 107943 ...
-
bioRxiv - Cell Biology 2020Quote: ... obtained from Dharmacon) into pUAST vectors containing a C-terminal Venus open reading frame (Wang et. al, 2012, Addgene plasmid 35204). Transgenes were sequenced and then injected into embryos containing an attP8 site on the X chromosome (BDSC stock #32233 ...
-
bioRxiv - Cancer Biology 2020Quote: ... The pBabe-MSCV-NrasG12D-Ires-RFP vector was cloned by excision from a donor Nras12D open reading frame plasmid (Addgene # 14725) using BamHI ...
-
bioRxiv - Molecular Biology 2022Quote: FLAG-NKX2-1 or FLAG-GFP open reading frame (ORF) was cloned into pLEX_306 (a gift from David Root, Addgene plasmid #41391). Cells stably expressing Cas9 were generated by infection with the lentiCas9-Blast plasmid (Addgene # 52962 ...
-
bioRxiv - Developmental Biology 2022Quote: ... a pcDNA Flag HA vector with the Sufu open reading frame cloned from pcDNA Su(fu) (CT #116) (Addgene plasmid: 13857)[24] using BamHI (New England Biolabs ...
-
bioRxiv - Genetics 2022Quote: The targeting construct was generated on the PUC19 backbone with the iCre open reading frame and the polyA sequences from the pCAG-iCre plasmid (Addgene 89573) (Weinberg et al. ...
-
bioRxiv - Microbiology 2021Quote: ... Lentiviral vectors encoding N-terminal 3xFLAG and V5 tandem tagged versions of BPLF1 aa 1-325 and the corresponding catalytic mutant BPLF1-C61A under control of the doxycycline-inducible pTight promoter were produced by cloning the corresponding open reading frames(Ascherio & Munger, 2015) into ta modified version of the pCW57.1 plasmid (gift from David Root, Addgene plasmid #41393). The Gal1/10 His6 TEV Ura S ...
-
bioRxiv - Microbiology 2021Quote: ... The open reading frame of hACE2 (kindly provided by Sonja Best from NIAID/NIH) was cloned into pSBbi-Bla vector (Addgene # 60526) as described 31.
-
bioRxiv - Genomics 2022Quote: ... the SRSF3 open reading frames were subcloned into pCW57-MCS1-P2A-MCS2 (Blast) (a gift from Adam Karpf, Addgene plasmid #80921) [49] by restriction enzyme digest using EcoRI and BamHI (New England Biolabs).
-
bioRxiv - Neuroscience 2022Quote: ... Err2EnR was generated by fusing the open reading frame of the transcriptional repressor domain of Drosophila Engrailed (amplified from CAG-EnR plasmid, Addgene plasmid #19715, Addgene, Watertown, USA) to Err2.