Labshake search
Citations for Addgene :
351 - 400 of 686 citations for B2M Cynomolgus HEK293 Flag His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin plasmid constructs were purchased from Addgene (FLAG-β-catenin WT (Addgene plasmid #16828; http://n2t.net/addgene:16828; RRID:Addgene_16828), FLAG-β-catenin K49R (Addgene plasmid # 44750 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K49R (Addgene plasmid # 44750; http://n2t.net/addgene:44750; RRID:Addgene_44750), FLAG-β-catenin K19R (Plasmid #Addgene plasmid # 44749 ...
-
bioRxiv - Cell Biology 2023Quote: ... and pUbC-FLAG-24xSuntagV4-oxEBFP-AID-baUTR1-24xMS2V5-Wpre (Addgene plasmid # 84561) were gifts from Dr ...
-
bioRxiv - Developmental Biology 2023Quote: The mouse Runx1 overexpression plasmid pCDNA3.1-Flag-Runx1 was purchased from Addgene. The mouse Runx2 plasmid pCMV-Flag-mRunx2 was purchased from Origene ...
-
bioRxiv - Neuroscience 2023Quote: ... The desired region of plasmid pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) was amplified by PCR ...
-
bioRxiv - Molecular Biology 2023Quote: ... VHL-NbGFP4-FLAG sequence was subsequently cloned into TLCV2 lentivector (Addgene #8736027) by PCR using Age I/Nhe I sites ...
-
bioRxiv - Microbiology 2023Quote: ... pCMV-Tag2b-Flag-NLRC5 (Addgene plasmid #37521; http://n2t.net/addgene:37521; RRID:Addgene_37521), pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509 ...
-
bioRxiv - Neuroscience 2023Quote: ... a Streptavidin-binding peptide-FLAG (SFB)-tagged USP7 construct56 (Addgene plasmid #99393) was transfected into HEK293T cells via PEI transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP-P65 reporter (#127172) and Flag-KEAP1 (#28023) plasmids were from Addgene. NL3.2.NF-ΚB-RE (#N1111 ...
-
bioRxiv - Cell Biology 2023Quote: p4489 Flag-βTRCP was a gift from Peter Howley (Addgene plasmid # 10865) (Zhou et al ...
-
bioRxiv - Cell Biology 2024Quote: ... pGEX6P1-DEST-FLAG was a gift from Andrew Jackson & Martin Reijns (Addgene plasmid # 119754 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The FLAG-HA-tagged YTHDC1 plasmid was purchased from Addgene (plasmid # 85167).
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Genomics 2023Quote: Plasmids in the pCAG backbone used to overexpress TWIST1 and ALX4 in HEK293 cells were cloned by digesting the pCAG-NLS-HA-Bxb1 plasmid (Addgene plasmid # 51271) prepared from dam-/dcm- E ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles were produced in HEK293 cells after transient transfection of the packaging vectors psPAX.2 and pMD.G2 (Addgene #12260 and #12259). After viral transduction ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and subcloned in-line with his-tagged MBP construct (2CT-10 vector, Addgene plasmid #55209). Recombinant MBP-EndoH fusion was expressed in and purified from E ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral particles carrying a luciferase reporter were produced at the EPFL Gene Therapy Facility by transfecting HEK293 cells with the pHIV-Luc-ZsGreen plasmid (Addgene, Catalog No. 39196). Lentivirus-containing supernatants were collected and concentrated by centrifugation (1,500 g for 1 hr at 4°C) ...
-
bioRxiv - Cell Biology 2019Quote: Rab39b cDNA was cloned using Gibson Assembly into pEGF-N1-Flag plasmid (Addgene #60360 ...
-
bioRxiv - Physiology 2019Quote: ... pLKO-puro FLAG SREBP1 was a gift from David Sabatini (Addgene plasmid # 32017). PPRE-X3-TK-luc was a gift from Bruce Spiegelman (Addgene plasmid # 1015) ...
-
bioRxiv - Physiology 2019Quote: pAd-Track FLAG-SIRT1 was a gift from Pere Puigserver (Addgene plasmid # 8438). pAdtrack CMV plasmid was a gift from Bert Vogelstein (Addgene plasmid # 16405) ...
-
bioRxiv - Biochemistry 2021Quote: ... pFRT/TO/FLAG/HA-DEST PABPC4 was from Thomas Tuschl (Addgene plasmid #19882) (Landthaler ...
-
bioRxiv - Neuroscience 2021Quote: ... Flag-HA-HuD was obtained by cutting the pFRT-TODestFLAGHA_HuD plasmid (Addgene, #65757) with PaeI and BglII enzymes ...
-
bioRxiv - Cell Biology 2021Quote: ... HDAC6-FLAG (#13823) and pEF5B-FRT-GFP-aTAT1 (#27099) were purchased from Addgene. Tub-GFP-HDAC6 was made by PCR amplifying the HDAC6 sequence from the HDAC6-FLAG construct and ligating the PCR amplicon into the Tub-GFP construct ...
-
bioRxiv - Cell Biology 2022Quote: The coding sequence of Mettl3 was amplified from pcDNA3/Flag-METTL3 (Addgene, #53739) and inserted into the lentiviral plasmid pLOXCMV (Qi et al ...
-
bioRxiv - Physiology 2022Quote: ... FLAG-IKKβ-S177E/S181E (#11105) and HA-Ubiquitin (#18712) were acquired from Addgene. HA-TRAF6 was generated by cloning the TRAF6 fragment into pcDNA3-HA plasmid ...
-
Histone H3K36me2-specific methyltransferase ASH1L is required for the MLL-AF9-induced leukemogenesisbioRxiv - Cancer Biology 2021Quote: The pMIG-FLAG-MLL-AF9 retroviral vectors as obtained from Addgene (Plasmid #71443). Retroviral vectors were generated by co-transfection of retroviral vectors with pGag-pol ...
-
bioRxiv - Cancer Biology 2021Quote: ... The pcDNA5-FRT/TO-LacR-FLAG-TOPBP1 plasmid was obtained from Addgene (#31313). Point mutants were introduced by site-directed mutagenesis using Quikchange (Agilent) ...
-
bioRxiv - Developmental Biology 2019Quote: ... pcDNA-HDAC6-FLAG was a gift from Dr.Tso-Pang Yao (Addgene plasmid # 30482).
-
bioRxiv - Molecular Biology 2019Quote: ... Flag-PIAS4 WT plasmid was a gift from Ke Shuai (Addgene plasmid # 15208). RNF4-Myc-FLAG WT plasmid was purchased from OriGene (CAT# ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA of human SNAI1 was subcloned from Flag-Snail WT (Addgene 16218) into pWZL-Blast-GFP (Addgene 12269 ...
-
bioRxiv - Cell Biology 2019Quote: ... The pcDNA3-Flag-Apex-Nes was a gift from Alice Ting (Addgene, 49386). The N1-mTurquoise2 (Addgene ...
-
bioRxiv - Cancer Biology 2020Quote: ... FLAG-tagged human EZHIP was cloned into the pMT-puro vector (Addgene #17923). Transfections were performed with 2 μg plasmid DNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... A plasmid expressing anti-CRISPR protein (pEJS581; pCSDest2-AcrIIC4Hpa-FLAG-NLS; Addgene # 113436) was included in the triple-transfection packaging process to maintain intact rAAV:HDR:cleaved plasmids during production ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA-HDAC6-FLAG was a gift from Tso-Pang Yao (Addgene plasmid # 30482) (Kawaguchi et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293T cells were transfected with plasmids expressing Flag-tagged mTOR (Plasmid #26603, Addgene) together with HA-tagged Raptor (Plasmid #8513 ...
-
bioRxiv - Molecular Biology 2022Quote: ... K562 or HeLa cells were transfected with pEBB-Flag-GCN5 (Addgene, Plasmid #74784) or an empty vector using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: lenti SYN-FLAG-dCas9-KRAB-MeCP2 was a gift from Jeremy Day (Addgene plasmid # 155365 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pENTR4-FLAG (w210-2) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17423 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG-β-catenin K19R (Plasmid #Addgene plasmid # 44749; http://n2t.net/addgene:44749; RRID:Addgene_44749), FLAG- β-catenin K19R/K49R(Addgene plasmid #44751 ...
-
bioRxiv - Cancer Biology 2023Quote: ... FLAG- β-catenin K19R/K49R(Addgene plasmid #44751; http://n2t.net/addgene:44751; RRID:Addgene_44751)) ...
-
bioRxiv - Cell Biology 2023Quote: ... and N131-N160 was inserted using the pEXPqcxip-hCCDC47-FLAG vector (Addgene, 159141) as a template and primers designed to include a C-terminus MYC-tag ...
-
bioRxiv - Cancer Biology 2024Quote: ... C-terminally FLAG-tagged ASXL1 p.G646Wfs*12 and p.Y591X were obtained from Addgene. The MSCV-T2A-Puromycin vectors encoding 3xFLAG-tagged full-length ASXL1 and truncated ASXL1 were generated by PCR amplification followed by sub-cloning using Gibson assembly.