Labshake search
Citations for Addgene :
3251 - 3300 of 3325 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... pENTR-backbone was created by treating pENTR-Luc (w158-1, a gift from Drs. Eric Campeau and Paul Kaufman; Addgene plasmid #17473) with NcoI and XbaI (New England Biolabs ...
-
bioRxiv - Genetics 2020Quote: ... BLRR was then transferred to pLenti CMV Puro DEST (w118-1)(33) (a kind gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17452) from pENTR-BLRR using Gateway LR Clonase II Enzyme mix (111791020 ...
-
bioRxiv - Molecular Biology 2021Quote: ... HEK293T cells were plated at 2.2 x 105 ml−1 and transfected the following day with shRNA-expressing plasmid (shSp7 or shLacZ plasmid) along with psPAX2 (Addgene, plasmid 12260) and pMD2.G (Addgene ...
-
bioRxiv - Neuroscience 2019Quote: ... eGFP expression was driven in DAT+ neurons by an AAV1:CAG:FLEX-eGFP vector (UPenn [Addgene], cat. no. AV-1-ALL854 [51502-AAV1]). For in-vivo fiber photometry of dopamine release (Fig ...
-
bioRxiv - Molecular Biology 2019Quote: ... ORF66 aa 1-200 was cloned into the NotI and XhoI sites of pcDNA4/TO-2xStrep (N-terminal tag) to generate pcDNA4/TO-2xStrep-ORF66 1-200 (Addgene plasmid #130954) and ORF66 aa 200-429 was cloned into the BamHI and XhoI sites of pcDNA4/TO-2xStrep (C-terminal tag ...
-
bioRxiv - Cell Biology 2021Quote: ... HEK293T cells were transiently transfected with 1 µg of a PCR cassette and 1 µg of pCAG- enAsCas12a(E174R/S542R/K548R)-NLS(nuc)-3xHA (gift from Keith Joung & Benjamin Kleinstiver, Addgene plasmid # 107941) using TransIT293 (Mirus ...
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding CGI-99 (Uniprot Q9Y224) was cloned into site 1 of the UC Berkeley MacroLab 5A vector (gift from Scott Gradia, Addgene plasmid #30121), while DNA sequence encoding FAM98B (Uniprot Q52LJ0 ...
-
bioRxiv - Immunology 2021Quote: ... and control Luciferase (shLuc, SHC007) were made by ligating annealed oligonucleotides into pLKO.1 (TRC cloning vector, a gift from David Root (Addgene plasmid #10878)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and amplified ZBP1 cDNA using forward: GGGAATTCATGGCCCAGGCTCCTGCT and reverse: TAGCGGCCGCCTAAATCCCACCTCCCCA primers from pEGFPN.1 vector cloned into LeGO-iG2-IRES-EGFP vector (Addgene plasmid #27341) between EcoRI and NotI sites followed by 5x strep-tag II (TGGAGCCATCCGCAGTTTGAAAAA ...
-
bioRxiv - Cancer Biology 2021Quote: ... an annealed small interfering RNA cassette with a targeting sequence of GGACAACCCGUACAUCACC for RKTG and scramble sequences were inserted into the pLKO.1.-puro vector (Addgene, MA, USA) downstream of the U6 promoter Lentiviruses were obtained by co-transfecting a mixture of the indicated shRNA plasmid ...
-
bioRxiv - Microbiology 2020Quote: ... with the primers 5’-gtgtAGGCCTaaaaATGATTCGTGTTTATTTGATAATTTTAATGCA-3’ and 5’-gtgtGCTAGCCTAGAAAATGTTAATCGAAGTTTTGCGT-3’ and inserted into the NaeI-NheI sites of pCFJ150-mCherry(dpiRNA)::ANI-1(AHPH) (a gift from Heng-Chi Lee, Addgene plasmid #107939). Three expression constructs of PU6::rrf-3 sgRNAs were amplified by PCR from pDD162 using the primers 5’-GTATTGTGTTCGTTGAGTGACC-3’ ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Neuroscience 2021Quote: For Ca2+ indicator expression at M1, recombinant AAV vectors (rAAVs, serotype 1) encoding jRGECO1a under the control of the synapsin promoter (Addgene #100854-AAV1) was stereotaxically delivered as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... pcDNA3.1-HA-UBA6, containing the coding sequence for UBA6 (aa1-1052, Uniprot: A0AVT1) was a gift from Marcus Groettrup (Addgene plasmid #136995). UBA6 was subcloned into pDARMO with an N-terminal FLAG-tag ...
-
bioRxiv - Microbiology 2022Quote: Individual guide RNA (gRNA) sequences (Supplemental Table 1) were cloned into BsmBI-digested lentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang [10]) and resulting lentiviral stocks prepared as previously described [11] ...
-
bioRxiv - Biochemistry 2022Quote: ... by Gateway LR reactions (Resulting pAG416GPD-PpMAX1c). Then these constructs were co-transformed with ATR1 (NADPH-CYP reductase 1 from A. thaliana) expression vector (Addgene, Catalog # 178288) into the Saccharomyces cerevisiae wild-type strain CEN.PK2-1D using the Frozen-EZ yeast transformation II kit (Zymo Research ...
-
bioRxiv - Plant Biology 2022Quote: ... we first added the FASTRED seed coat selection cassette (57, 58) and a MoClo (59) Level 1 acceptor site to the binary vector pICH86966 (Addgene plasmid #48075). pHAT7-HAT7-mCitrine and pGTL1-GTL1-mCitrine were assembled into this FASTRED destination vector using Level 1 BsaI golden gate assembly ...
-
bioRxiv - Neuroscience 2023Quote: Calcium indicator expression in vLGN/IGL neurons was achieved with AAV-hSynapsin1- FLEx-axon-GCaMP6s (1 × 1012 genome copies per ml, Addgene, 112010-AAV5) for retinal expression AAV2.7M8-syn-GCaMP8m viral vectors (1 × 1013 genome copies per ml) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and a non-targeting control (F: GCACTACCAGAGCTAACTCAGATAGTACT) were designed using the BROAD Institute design tool and cloned into pLKO.1 vector (Addgene, Cat# 8453), followed by validating the successful insertions using Colony-PCR and Sanger sequencing ...
-
bioRxiv - Immunology 2024Quote: ... Production of lentiviral particles was performed by transient co-transfection (polyethylenimine:DNA at 3.5:1 ratio) of HEK 293T cells with the second-generation packaging system plasmid psPAX2 and pMD2.G (Addgene, 12260 and 12259). Viral supernatants were harvested at 48h post-transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no. 65417), packaged at UPenn Vector Core ...
-
bioRxiv - Cancer Biology 2023Quote: ... and SNAI1 knockdown cells were generated by cloning respective shRNA sequences into the 3rd generation lentiviral plasmid pLKO.1 TRC cloning vector (Addgene, cat# 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Biochemistry 2024Quote: We also constructed pFGH1-UTG-mTagBFP2 as empty vectors by inserting PCR-amplified mTagBFP2 from pLKO.1 - TRC (a gift from Timothy Ryan; Addgene plasmid #191566) into digested backbone from pFGH1-UTG ...
-
bioRxiv - Cancer Biology 2023Quote: ... targeting exon 6 and exon 9 of human ATRX or mouse Atrx (Supplementary Table 1) were cloned into CRISPR-Cas9 lentiCRISPR v2 vector (gift from Feng Zhang, Addgene plasmid #52961). Lentivirus was produced in 293FT cells ...
-
bioRxiv - Bioengineering 2023Quote: ... The assembled fragment was sandwiched by two Smn1 intron 1 gRNA target sequence and subcloned into between ITRs of PX552 purchased from Addgene (Addgene 60958), and generated pAAV-SMN1-HITI ...
-
bioRxiv - Cell Biology 2023Quote: His-tagged Set9 protein expression was induced overnight at room temperature with 1 mM IPTG using BL21(DE3) Escherichia coli transformed with pET28 Set9 plasmid (Addgene plasmid #24082). Cells were pelleted at 7000 rpm for 20 minutes at 4°C using rotor JA-10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... full-length ROS1 cDNA was cloned using the SalI and XhoI sites in the multiple cloning site of pENTR4-No ccDB (696-1) vector (Addgene Plasmid #17424) via In-Fusion™ cloning using PCR amplification that included the adition of C-terminal Flag tag ...
-
bioRxiv - Neuroscience 2023Quote: ... or left IC (0.9 mm caudal and 1 mm lateral from lambda suture) to inject 100-200 nL of pAAV-Syn-Chronos-GFP virus (Addgene #59170-AAV1). At the end of the surgery ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.3 x 1013 vg/mL) or 200 nL/side AAV5-CMV-HI-eGFP-Cre-WPRE-SV4 (Addgene; ≥ 1 x 1013 vg/mL) was injected at a rate of 100 nL/min into the insula of Pdynlox/lox and Oprk1lox/lox mice ...
-
bioRxiv - Developmental Biology 2023Quote: ... The destination vector used in this study was pLenti CMV Neo DEST (705-1) (gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17392). Once validated ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNAs of mKif6 FL (1-803aa) and ML (360-803aa) were subcloned into pmCherry2-C1 vector (a gift from Michael Davidson, Addgene plasmid # 54563). mCherry was removed and mKif6 (1-493aa)-mNeonGreen was added into pmCherry2 vector ...
-
bioRxiv - Neuroscience 2023Quote: ... a 10-fold serial dilution in H20 was prepared of a commercially available bacterial plasmid (pBR322) containing the JCPyV Mad-1 full sequence (girt from Peter Howley, Addgene plasmid # 25626) [46] ...
-
bioRxiv - Cancer Biology 2023Quote: ... cloned into pLenti PGK Neo DEST (pLenti PGK Neo DEST (w531-1) a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 19067) by using the Gateway LR Clonase II Enzyme Mix (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... and the 6xHis-SUMO tag was removed by enzymatic cleavage using human Sentrin-specific protease 1 (SENP1) catalytic domain (derived from pET28a-HsSENP1, that was a gift from Jorge Eduardo Azevedo (Addgene plasmid #71465) at 4°C overnight27,28 ...
-
bioRxiv - Microbiology 2023Quote: The following plasmids were used in this study: pLenti CMV Blast DEST (706–1) (Ax203, a gift from Eric Campeau & Paul Kaufman, Addgene plasmid #17451); K8.1-OneStrep (OneStrep Tag ...
-
bioRxiv - Cancer Biology 2023Quote: ... For each microgram crude eccDNA we spiked in 1 ng pUC1932 (was a gift from Joachim Messing, Addgene plasmid # 50005; RRID: Addgene_50005) and 1 ng egfr fragment to generate crude circular DNA mixture.
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Neuroscience 2024Quote: Neurons were isolated by first virally labeling neurons from the same batch with pAAV-CAG-tdTomato for 24 hours (1:50 dilution, Addgene 59462-AAV1) prior to incorporation into miBrain or monoculture ...
-
bioRxiv - Neuroscience 2024Quote: ... 1) and inserted into sites of hSyn promoter in AAV-U6-sgRNA-hSyn-mCherry (a gift from Alex Hewitt, Addgene plasmid # 87916) (AAV-hMAG-mcherry) ...
-
bioRxiv - Cell Biology 2024Quote: ... The third generation HIV-1 derived lentiviral vector LeGO-iG2-Puro+-Luc2 expresses the Luc2 variant of firefly luciferase (cloned from AddGene Plasmid 24337) under the control of an SFFV-promoter ...
-
bioRxiv - Molecular Biology 2024Quote: ... with HA-tag at the N-terminal and GFP-tag at the C-terminal were cloned in pEGFP-N3 expression vector (Addgene #6080-1) (Table S8 ...
-
bioRxiv - Immunology 2024Quote: ... pcDNA3-sACE2(WT)-8his encoding soluble human ACE2 (UniProt Q9BYF1, residues 1-732) was a gift from Erik Procko (Addgene plasmid #149268) and was expressed and purified as described above for the other recombinant proteins.
-
bioRxiv - Molecular Biology 2024Quote: Mission plasmids encoding a control scrambled shRNA (Scr) and individual shRNA oligos against Pkm1 and Pkm2 (Supp. Table 1) were cloned in the pLKO_TRC001 vector (Addgene cat no. 10878) as previously described (54) ...
-
bioRxiv - Cell Biology 2024Quote: ... These were then assembled into a pLenti CMV V5-LUC Blast (w567-1) digested with BstXI (a gift from Eric Campeau (Addgene plasmid # 21474). Cy3 labeled collagen was prepared as previously described (Doyle ...
-
bioRxiv - Neuroscience 2024Quote: Cre-dependent recombinant adeno-associated virus (rAAV) for GCaMP7f (rAAV1-syn-FLEX-jGCaMP7f-WPRE, Addgene #1944820-AAV1, titer: ≥1:1013 vg/mL) were used to express GCaMP7f in the hippocampus of Vgat-Cre mice ...
-
bioRxiv - Biochemistry 2022Quote: ... The construct was packaged into lentivirus using HEK293T cells and delivered into target cells together with pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid no. 26730) for tetracycline inducible expression ...
-
bioRxiv - Biochemistry 2022Quote: ... These GFP positive cells were transduced with lentiviral particles for pLenti CMV rtTA3 Hygro (w785-1) (a gift from Eric Campeau Addgene plasmid number 26730) for tetracycline inducible expression and selected using hygromycin (200μg/ml) ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Neuroscience 2020Quote: ... a pair of complementary 20 bp oligos for each guide RNA sequence was annealed and cloned into pX330 (Addgene 42230; for guide 1) or pSG (a shuttle vector ...