Labshake search
Citations for Addgene :
3151 - 3200 of 3325 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Microbiology 2021Quote: ... hairpin loop sequence and shRNA sequence were synthesised (IDT technologies) and annealed oligos cloned into pLKO.1 TRC cloning vector (Addgene #10878) using the unique Age1/EcoR1 sites ...
-
bioRxiv - Neuroscience 2020Quote: Plasmid Cry2olig-mCherry-tau 1-441 was prepared by inserting DNA fragment encoding the full length tau into the linearized Cry2olig-mCherry (Addgene 60032) backbone at the C-terminus of mCherry using Gibson assembly® Cloning kit (New England BioLab Int.) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The annealed oligos were diluted (1:200) and cloned into pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-Puro (encoding dCas9-KRAB; Addgene # 71236) using a Golden Gate Assembly strategy (containing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Neuroscience 2021Quote: ... Twenty hemizygous ChAT-Cre mice were bilaterally injected with Cre-dependent inhibitory DREADD fused with mCherry reporter AAV8-hsyn-DIO-hM4Di-mCherry (1×1013 VG/ml; Addgene, 44362) or control virus (AAV8-hsyn-DIO-mCherry ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Immunology 2022Quote: ... Vector psPAX2 containing the untagged coding sequence for HIV-1 gag-pol was a gift from Didier Trono (Addgene plasmid # 12260).
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Cell Biology 2022Quote: All shRNA were generated by ligation of oligos into AgeI and EcoRI of pLKO.1 (Addgene plasmid #8453; Addgene, Teddington, UK). Lower case sequences represent the targeted sequences.
-
bioRxiv - Systems Biology 2019Quote: P(dat-1)::YFP and P(dat-1)::alpha-Synuclein-YFP were generated by cloning the P(dat-1) promoter in the plasmids pRP2386 28 and pPD30.38 (Addgene plasmid # 1443) respectively ...
-
bioRxiv - Molecular Biology 2019Quote: The gene encoding full length Francisella novicida (Fn) Cas9 nuclease residues 1-1629 bp) was PCR amplified using PX408 (Addgene 68705) as a template and cloned in pET28-His-10-Smt3 vector (a kind gift from Prof ...
-
bioRxiv - Cancer Biology 2020Quote: shRNA targeting CDK9 was cloned into pLKO.1 lentiviral vector (Sequence: Forward: CCGGGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAAGTCGAACTTTTG Reverse:AATTCAAAAAGTTCGACTTCTGCGAGCATGACTCGAGTCATGCTCGCAGAA GTCGAC. Luciferase vector was purchased from Addgene (plasmid #17477). Recombinant lentiviral vector and packaging vector (pCMV-dR8.9 and pMD2.G-VSVG ...
-
bioRxiv - Genetics 2019Quote: ... were ordered from Integrated DNA Technologies and after phosphorylation and annealing were cloned into pLKO.1 - TRC shRNA cloning vector (Addgene #10878) into AgeI/EcoRI site ...
-
bioRxiv - Neuroscience 2019Quote: ... The donor plasmid for homologous recombination was constructed by using a Golden Gate assembly [92] to recombine four DNA elements: 1) A backbone with ampicillin resistance (pBS-GGAC-ATGC plasmid (a gift from Frank Schnorrer, Addgene #60949)[93] ...
-
bioRxiv - Cell Biology 2020Quote: Oligo duplexes containing a single guide (sg)RNA sequence for ACLY (as shown in Figure 1-figure supplement 1A) were inserted into pCas9(BB)-2A-GFP (a gift from Feng Zhang, Addgene #48138) following the published procedures (Ran et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... Nfia/bxlox/lox;Sun1-sGFP and GLASTCreERT2;Sun1-sGFP control mice were intravitreally injected with 1 μl of AAV9-pCAG-Flex-Tdtomato (Addgene #28306) at 1×10¹³ vg/mL and treated with Tamoxifen diet for 3 weeks ...
-
bioRxiv - Cell Biology 2020Quote: The Fucci reporter construct (pLL3.7m-Clover-Geminin(1-110)-IRES-mKO2-Cdt(30-120)) was a gift from Michael Lin (Addgene plasmid #83841)35 ...
-
bioRxiv - Genomics 2019Quote: ... shRNAs against KAP1 (shKAP1-B and shKAP1-D) were cloned into the pLKO.1.puro vector obtained from Addgene (http://www.addgene.org) using AgeI and EcoRI sites ...
-
bioRxiv - Developmental Biology 2019Quote: Ubi-SpCas9::P2A::mPicota::T2A::mCitr(#1)trine-polyA-U6c-gRN(#7)NA#1: we used multisite-Gateway cloning to recombine: i) a p5E ubi vector (34, Addgene #27320), ii ...
-
bioRxiv - Developmental Biology 2019Quote: ... The p3E vector was built by cloning a U6c-gRN(#7)NA#1 fragment (gBlock, IDT) into a KpnI/XhoI site in p3E-MCS (Addgene #75174).
-
bioRxiv - Cell Biology 2021Quote: ... A gBlock containing sequence for SNAP-V5 tags was inserted into pLenti CMVTRE3G eGFP Blast (w818-1) (gift of Eric Campenau, Addgene #27568) at the AgeI restriction site using Gibson Assembly to make pLTRE3G-SNAP-V5-eGFP ...
-
bioRxiv - Molecular Biology 2021Quote: ... CUG-targeting and non-targeting short hairpin RNAs (shRNAs) matching the corresponding Cas13d spacer sequences were cloned into the pLKO.1 vector (Addgene, #10878) by AgeI and EcoRI digestion and ligation of 5’-phosphorylated DNA duplexes using T4 DNA ligase (NEB ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Cell Biology 2020Quote: Lentiviruses were produced by co-transfecting 1 μmol of pLOVE-mEmerald-MCAK or pLOVE-mEmerald-MCAK-mCherry with the packaging plasmids dRT-pMDLg/pRRE (Addgene #60488), pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA-mediated knockdown of CCL5 and CXCL10 in the dMMR MC38 cells was achieved using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Stably knocked down cells were selected with 250 ug/ml hygromycin and knockdown was confirmed by Western blot.
-
bioRxiv - Cell Biology 2022Quote: ... listed in Supplementary Table 1) were cloned into the BsmBI restriction site of the Lenti-Cas9-gRNA-TagBFP2 vector (Addgene 124774) and packaged in 293T cells by co-transfection with pMD2.G (Addgene 12259 ...
-
bioRxiv - Neuroscience 2022Quote: ... In earlier experiments AAV1:CBA:FLEX:Arch-eGFP (200nl;5.48x1012 vg/ml; AV-1- PV2432; University of Pennsylvania vector core, Philadelphia, PA, USA, now at Addgene, 22222 - AAV1) was used ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP1-10 plasmid (pHAGE2-EF1a-GFP1-10-IRES-Puro) was generated by cloning GFP1-10 from pcDNA3.1-GFP(1-10) (Addgene Plasmid #70219) into a lentiviral vector that contains EF-1α promoter and Puromycin selection marker ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA clones harboring a blasticidin-resistance gene were generated by cloning validated oligonucleotides into the EcoRI/AgeI sites of pLKO.1-Blast (Addgene, #26655). Gene-specific shRNA lentiviral vectors with a pLKO.1 backbone were purchased from Sigma-Aldrich.
-
bioRxiv - Biochemistry 2022Quote: ... expression plasmid was cloned by PCR amplification from full length ScTop2 12URA-B vector followed by insertion into a modified 1-B (Addgene #29653) E ...
-
bioRxiv - Cell Biology 2022Quote: ... reporter under the constitutive elongation factor 1-α (EF1α) promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486 ...
-
bioRxiv - Genetics 2022Quote: ... sgRNA oligos with BbsI sticky ends (IDT, 25nmole standard desalted, Supplementary Table 1) were ligated into the pDG459 plasmid (Addgene 100901) as previously described 45 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV plasmids carrying either cDNA for respective genes downstream of a CMV promoter were co-transfected with pAAV2/1 (Addgene #112862) encoding the AAV genes rep and cap ...
-
bioRxiv - Plant Biology 2023Quote: ... The final construct was assembled by combining the two Level 1 sgRNA cassettes with cassettes for resistance to kanamycin pICSL11024 (Addgene#51144) and constitutive expression of SpCas9 (pEPQD1CB0001 ...
-
bioRxiv - Genomics 2022Quote: sgRNA-CRISPR library targeting 550 chromatin regulators (Suppl Table 1) was ordered from IDT Technologies and cloned using Gibson assembly in CRISP-seq backbone (Addgene #85707). The Gibson assembly product was electroporated in Endura ElectroCompetent cells following the manufacturer’s protocol (Endura #60242-2 ...
-
bioRxiv - Neuroscience 2022Quote: ... Adeno-associated virus for expressing jGCaMP6f or jGCaMP7f under the synapsin-1 promoter (AAV1-syn-jjGCaMP6f-WPRE-SV40, Addgene, 100837; AAV1-syn-jjGCaMP7f-WPRE, Addgene, 104488) was injected into the wS1 at depth of 250 μm below the dura and at a rate of 1 nL/sec (100 nL total) ...
-
bioRxiv - Physiology 2022Quote: ... reporter under the constitutive elongation factor 1-α (EF1α) promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid # 72486 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... by high fidelity Q5 polymerase PCR using primer set given table-1 and cloned purified hACE2 gene fragment into NheI and BamHI digested fragment of pLenti backbone (Addgene, 112675) by Gibbson assembly ...
-
bioRxiv - Biochemistry 2024Quote: ... pEGFP-C1-tagged plasmids containing the exon 1 of HTT with 23 CAG repeats (GFP-Q23: wild-type HTT. Addgene, #40261) or 74 CAG repeats (GFP-Q74 ...
-
bioRxiv - Cell Biology 2024Quote: ... control or mir-218-1-overexpressing HTR8 cells were seeded into 12-well plates and were co-transfected with 1 µg/mL of 5X NFκB luciferase reporter (64) (Addgene plasmid #12453) construct and 20 ng/mL of Renilla luciferase vector (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Neuroscience 2024Quote: ... we used OT-IRES-Cre pups injected at P0 into the PVN with a Cre-dependent rAAV2/1 vector expressing eOPN3 (pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE; Addgene #125713).
-
bioRxiv - Cell Biology 2022Quote: ... replication-deficient lentiviruses were produced and titrated as described by co-transfection of the resulting constructs in HEK-293T cells with the HIV-1 packaging plasmid psPAX2 (Addgene #12260) and the plasmid pMD2.G (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Microdomain targeting was accomplished using N-terminal fusions of tags to the matrix using 2xCOX8A (tag corresponds to Cox8A N-terminal residues 1-25, from Addgene 136470), the IMS using SMAC (residues 1-59 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488; AAV1-syn-jGCaMP7f-WPRE, Addgene 162376) was injected into the wS1 at depths of 250 μm and 120 μm below the dura and at a rate of 1 nL/sec (50 nL total per location) ...
-
bioRxiv - Neuroscience 2023Quote: A Cre-dependent inhibitory optogenetic construct halorhodopsin (eNpHR, AAV5-Ef1a-DIO eNpHR 3.0-EYFP at titer ≥ 1×10¹³ vg/mL, Addgene plasmid # 26966) or an empty vector (control ...
-
bioRxiv - Molecular Biology 2023Quote: Two oligos H3F3AN-1-73F CACCGTCAATGCTGGTAGGTAAGTA and H3F3AN-1-73R AAACTACTTACCTACCAGCATTGAC containing gRNA sequence were annealed and inserted into pSpCas9-2A-Puro vector (PX459, Addgene # 62988), digested with BbsI-HF enzyme (NEB ...