Labshake search
Citations for Addgene :
3051 - 3100 of 3325 citations for 6H 1 3 Thiazin 6 one 2 ethoxy 4 hydroxy 5 nitro 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... RPE-1 TUB-mRFP cells were generated in our lab by transduction with lentiviral vectors containing tubulin m-RFP (Addgene). HEK293T cells at a 50-70% confluence were co-transfected with lentiviral packaging vectors (16.6 μg of Pax2 ...
-
bioRxiv - Biochemistry 2022Quote: ... full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526, AddGene #98651), and FUS RGG3 with N-terminal histidine tag and MBP fusion (pTHMT FUS RGG3 (453-507) ...
-
bioRxiv - Cell Biology 2022Quote: ... organoid fragments were washed and resuspended in Opti-MEM supplemented with Y-27632 (10 µM) and 10µg of pSPgRNA plasmid together with the frame selector plasmid pCAS9-mCherry-Frame +1 (Addgene #66940) and the mNEON targeting plasmid (a kind gift from V ...
-
bioRxiv - Microbiology 2022Quote: Retrovirus particles for transduction and stable cell generation were produced in HNE-1 cells following JetPrime transfection of expression plasmids (pBabe neo, pBabe-HA-LMP1 neo) and packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Neuroscience 2021Quote: Other viruses used in the paper: AAV2/1-hSyn-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene #26973); AAV2/1-hSyn-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene #50474) ...
-
bioRxiv - Neuroscience 2020Quote: Full-length Susd4 mouse gene was cloned into the mammalian expression vector pEGFP-N1 (Addgene, Massachusetts, USA, Cat#6085-1) to express a SUSD4-GFP fusion construct under the control of the CMV promoter (pSUSD4-GFP) ...
-
bioRxiv - Cell Biology 2021Quote: ... Exogenous cells - MDCK cells were mosaically transfected using a CMV GFP vector (pLenti CMV GFP Blast (659-1) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid #17445 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmid 6His-MBP-TEV-huLbCpf1 (plasmid # 90096) (see Figure.1 and Supplementary M3 in the Supplement Data) was purchased from Addgene. After extracted from amplified strains ...
-
bioRxiv - Cancer Biology 2020Quote: Primary dMMR mouse or human organoids were generated using lentiviral transduction as described previously.25,30 Lentivirus was prepared as previously described using the pLKO.1 system (Addgene #10878) and containing the shRNA sequences in Supplementary Table 1.24 Lentivirus was concentrated 100X by ultracentrifugation ...
-
bioRxiv - Plant Biology 2022Quote: ... The first step involved the cloning of the tobacco sgRNA expression vectors (pYPQ131c, pYPQ132c, and pYPQ133c (Addgene, USA; Table 1) that contained the sgRNAs as inserts ...
-
bioRxiv - Immunology 2022Quote: ... annealed oligos were diluted 1:20 in molecular grade H2O and then ligated into Esp3I-digested pLentiCRISPR V2.0 (Addgene #52961). Ligation reactions were then transformed into Top10 competent E ...
-
bioRxiv - Cancer Biology 2019Quote: ... the HFF-1 cells were lentivirally transduced with GFP-H2B nuclear marker using the PGK-H2BeGFP system as described by Addgene and selected by flow sorting for GFP positive cells.
-
bioRxiv - Cell Biology 2019Quote: ... Annealed oligos were diluted 1/40 and 1 μl of insert was ligated into 10 ng of digested vector (pU6-sgRNA EF1Alpha-puro-T2A-BFP, Addgene plasmid #60955 digested with BstXI and Blpl ...
-
bioRxiv - Cell Biology 2019Quote: ... IRES DNA and mCherry cDNA were prepared by PCR using pEYFP SUMO-1 plasmid (from Mary Dasso: Addgene plasmid #13380), pWPI plasmid (from Didier Trono ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878; http://n2t.net/addgene:10878; RRID: Addgene 10878)) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and plasmids were obtained from Open Biosystems or cloned using pLKO.1-TRC (a gift from Dr. David Root (Addgene # 10878 ...
-
bioRxiv - Neuroscience 2021Quote: ... mDlx-Azurite was generated by replacing EGFP with Azurite from the pAAV-mDlx-GFP-Fishell-1 plasmid (Addgene number: 83900). Generation of pORANGE Btbd11 constructs were generated using the pORANGE Cloning template vector (Addgene number ...
-
bioRxiv - Molecular Biology 2020Quote: ... The four guide sequences for the Ascl1 locus (see Table 1) were taken from (Black et al., 2016) and cloned into pmU6-gRNA (Addgene: 53187 ...
-
bioRxiv - Neuroscience 2020Quote: ... CMV-PercevalHR (1×1010 TU/mL, produced at the University of North Carolina Vector Core Facility based on plasmid # 49083, Addgene, kindly provided by Dr ...
-
bioRxiv - Microbiology 2021Quote: ... and pCT-CD63-GFP (SBI, CYTO120-PA-1) plasmids were transfected in HEK293T cells with the packaging plasmids pMD2.G (Addgene; number 12259 ...
-
bioRxiv - Neuroscience 2020Quote: To express oChIEF-mCitrine in pOXR1-Cre mice, a recombinant adeno-associated virus (rAAV, serotype 1, 4.8×1013 VC/ml titer) expressing FLEXed oChIEF-mCitrine (Addgene #50973) was package by Vector Biolabs (Malvern ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Biochemistry 2021Quote: Site-directed mutagenesis was performed on KRAS 1-169 (Q61H, isoform b, a gift from Cheryl Arrowsmith, Addgene plasmid #25153) to obtain the wild-type sequence ...
-
bioRxiv - Developmental Biology 2020Quote: ... a FLAG-tag version of the codon-optimized mouse DUX was amplified by PCR (Primers in Extended Table 1) from pCW57.1-mDUX-CA (Addgene 99284) and subcloned into the pBS31 plasmid (pBS31-FLAG_mDUX) ...
-
bioRxiv - Genomics 2021Quote: ... a gift from Bob Weinberg. The cloning of the shRNAs in the pLKO.1 plasmid was performed as per the Addgene’s pLKO.1 cloning protocol ...
-
bioRxiv - Biophysics 2020Quote: ... Then 1 μl of EGFP Lifeact-7 plasmid (mEGFP-Lifeact-7 was a gift from Michael Davidson; Addgene plasmid # 54610), 100 μl Opti-MEM ([+] HEPES ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Cell Biology 2020Quote: ... pWC223 encoding the motor domain of Drosophila kinesin 1 fused to BCCP (noted Kin1-biotin) was a gift from Jeff Gelles (Addgene plasmid # 15960 ...
-
bioRxiv - Neuroscience 2020Quote: All constructs containing the N/Q-rich region of the neuronal-specific Aplysia CPEB (residues 1-160) were cloned by PCR using a full-length clone (Addgene) as the template ...
-
bioRxiv - Immunology 2020Quote: A short-guide RNA targeting the BFL-1 transcriptional start site was cloned into the BsmbI-digested dCas9-KRAB-GFP (Addgene #71237, RRID: Addgene_71237) or lentiguide-puromycin (Addgene #52963 ...
-
bioRxiv - Molecular Biology 2021Quote: The knockdown plasmids for REST/NRSF and for the control GFP were constructed by ligating annealed primer pairs into the pLKO.1 vector (Addgene) between the EcoRI and AgeI sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... were co-transfected with either mKO2-hCdt1(30/120)/pCSII-EF or mAG-hGeminin(1/110)/pCSII-EF) and 2nd generation viral packaging plasmids VSV.G (Addgene #14888) and psPAX2 (Addgene #12260) ...
-
Importin α/β Promote Kif18B Microtubule Association to Spatially Control Microtubule DestabilizationbioRxiv - Cell Biology 2022Quote: ... or pLOVE-EGFP-Kif18B-siRNAR-EBBD plasmids with 1 μmol each of the packaging plasmids dRT-pMDLg/pRRE (Addgene #60488), pRSV-Rev (Addgene #12253) ...
-
bioRxiv - Genomics 2022Quote: cDNA encoding the short isoform of ETS-1 (p54) was cloned into pENTR vector and then into the destination vector MSCV-IRES-Thy1.1 DEST (Addgene: 17442) using Gateway cloning strategy (Gateway Clonase II ...
-
bioRxiv - Microbiology 2023Quote: ... and lentiviral particles expressing human TMPRSS2 (selection with 1 mg/ml G418). The TMPRSS2 (cat. 145843) and ACE2 (cat. 145839) lentiviral DNA clones (23) were purchased from Addgene and transfected into HEK293T cells together with pSPAX2 (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... 800-1000 nL of a AAV5-hSyn-dLight1.2 vector (~1 × 1013 viral genomes/mL, obtained from Addgene; catalog #AAV5-111068) was delivered into the LNAc (antero-posterior ...
-
bioRxiv - Physiology 2022Quote: ... (Gagoski et al., 2016) or the rhodopsin-muscarinic receptor type 1 chimera (opto-M1R) (Morri et al., 2018) were purchased from Addgene (plasmids 67130 and 106069 respectively ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: RNH1-KO K562 cells were infected with lentiviruses expressing ANG (pLenti CMV Blast GFP-ANG) or the empty vector pLenti CMV Blast DEST (706-1, Addgene) as previously described 52 ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... the human Angiogenin (ANG) full coding sequence (ORIGEN RC 208874) was cloned into the entry vector pENTR4-GFP-C1 (W392-1, Addgene) and then recombined into the destination vector pLenti CMV Blast DEST (706-1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... This fragment was subcloned by restriction (BamHI and XhoI) and ligation into the lenti-vector expression backbone plasmid pLenti-CMV-Blast-empty-(w263-1) (Addgene). Sequence integrity was validated with Sanger sequencing ...
-
bioRxiv - Molecular Biology 2024Quote: ... Annealing reactions were diluted 1:10 with water and then 1µL was used to ligate into 100ng of BsmBI digested pLentiGuidePuro vector (Addgene #52963) in 1x T4 DNA Ligase Buffer ...
-
bioRxiv - Neuroscience 2024Quote: ... rats received a bilateral prelimbic (PrL; AP: +2.8, ML: +/-0.6, DV: -3.8) infusion of AAV2.CamKII::hChR2(H134R)-EYFP (Addgene, titer: ∼1×1013) and a bilateral infusion of either AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP combined with an AAV2.hsyn::DIO-mCherry (Addgene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Two gRNAs targeting Exon 1 (targeting sequence GGGCGCGCTACCTGTCTCCG) and Exon 10 (targeting sequence GAACTGGACTTTGAAAGAGG) were cloned in BPK1520 (Addgene #65777) and transfected with Amaxa Nucleofector II together with BPK4410 ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Neuroscience 2023Quote: ... titer ≥ 1×1013 vg/mL) and pAAV-CAG-GFP (titer ≥ 7×1012 vg/mL) viral preps were purchased from Addgene (Addegene viral prep # ...
-
bioRxiv - Cancer Biology 2023Quote: Plasmids for CRISPR/Cas9-mediated Ilk knockout were generated by cloning oligonucleotides encoding 2 sgRNAs targeting the Ilk gene (1) between the BbsI sites of the eSpCas9(1.1) plasmid76 (a gift from Feng Zhang; Addgene; #71814). For Ilk re-expression ...