Labshake search
Citations for Addgene :
251 - 300 of 1062 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Cell Biology 2020Quote: ... Primers containing this targeting sequence (primers 11 and 12) were annealed and subcloned into the pU6-(BbsI) CBh-Cas9-T2A-mCherry vector (Addgene #64324) digested with BbsI.
-
bioRxiv - Cell Biology 2022Quote: ... T2A-GFP fragment was amplified by T2A-F and GFP-R primers using plenti-CMV-mCherry-T2A-GFP (Addgene plasmid #109427) as a template ...
-
bioRxiv - Molecular Biology 2020Quote: ... The YAP5SA gene was amplified with primers YAP1-5SA-Str-BglII and YAP1-5SA-End-SalI using pQCXIH-Myc-YAP-5SA (Addgene #33093) as a template and ligated into the pAAV-CMV plasmid ...
-
bioRxiv - Genomics 2019Quote: ... These primers amplify both candidate enhancers and previously assigned degenerate barcodes and add homology arms to the ORI vector (Addgene 99296)25 ...
-
bioRxiv - Genetics 2020Quote: ... a single guide sequence (primers JBW0001/2) targeting MSH2 exon 6 was cloned into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138) as described24 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and RPL22-3xHA (primers JG106/109; human cDNA template) with EcoRI/PstI digested pLV-TetO-hNGN2-P2A-eGFP-T2A-Puro (Addgene #79823) backbone ...
-
bioRxiv - Cancer Biology 2021Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5, Addgene, 68411). This lentiviral backbone was a gift from Dr ...
-
bioRxiv - Developmental Biology 2022Quote: ... 35 μl of hot glycerol was cooled to 4°C then 35 μl of the primer mixture and 25 μl of Tn5 (Addgene #112112) was added and mixed and held at 1 hr at RT with gentle pipet mixing every 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... were amplified using primers containing overhangs with the homology sites for GMAP cloning and inserted into a lentiviral vector (LV 1-5; Addgene, 68411). IL6-EGFP from pmIL-6promoterEGFP (Addgene 112896) ...
-
bioRxiv - Plant Biology 2022Quote: ... AA106 and AA107) and mNeonGreen (primer pair: AA108 and AA109) were amplified from Zea mays B73 cDNA and mNeonGreen-2A-mTurquoise2 (Addgene #98885), respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The dual guide backbone1-tRNA cassette was synthesised (Gblock, IDT) and amplified with primers containing the two guideRNA target sites followed by Gibson cloning into pX458 (Addgene #48138). Plasmids were transfected into the KOLF2_C1 hiPSC line with TransIT-LT1 (Mirus Bio ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2018] genomic DNA using RLO336/RLO338 and RLO337/RLO339 primers (Table 2) which introduce sequences homologous to the regions flanking the SacI and HindIII sites of pRG216 (Addgene #64528) [Gnügge and Rudolf 2017] ...
-
bioRxiv - Cell Biology 2023Quote: ... 2xP4M-SidM was first amplified using P3 and P4 primers and GFP:P4M-SidM2x (a gift from Prof. Tamas Balla, Addgene plasmid # 51472) as a template and introduced into the vector pHD22 ...
-
bioRxiv - Microbiology 2023Quote: ... with a PCR product containing a T2A-HygR cassette that was amplified using primers 3551/3552 and template lenti MS2-P65-HSF1_Hygro (Addgene Plasmid #61426). The initial control insert shRNA NT control #4 was replaced by digesting pZIP-ZsGreen-T2A-Hyg-shNT4 with NotI and MluI and inserting miR-30-based shRNAs for cFLIP (sh1 ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Labor-associated endogenous gene promoters were cloned into the pGL4.23 backbone either directly from gDNA (using overhang-containing primers) in the case of the Fos promoter (Addgene catalog #188113), or from transitional pJET-1.2 vector backbones containing the cloned promoter ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and the sgRNA cassette was amplified by the primers with SpeI and XhoI overhangs using pgRNA plasmid as the template (Addgene 44251). To construct the pBBR1-MCS1-plac-cas9-sgRNA backbone ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... tag-containing MAP3K7 forward primer (5’-cagtGGGCCCaccATGTA CCCATACGATGTTCCAGATTACGCTAGCGGCCGCATGTCTACAGCCTCTGCCG-3’) and its reverse primer (5’-ATAggatccTCATGAAGTGCCTTGTCGTTTC-3’) were used to amplify MAP3K7 from pDONR223-MAP3K7 plasmid (Addgene plasmid #23693) and cloned into the NotI and BamHI sites of lentiviral vector pHIV-Zsgreen (Addgene plasmid #18121 ...
-
bioRxiv - Cell Biology 2021Quote: ... MDA-MB-231 cell line stably expressing Flag–Rab40b-4A was created by cloning Rab40b-4A (primers purchased from IDT, Coralville, IA) into lentiviral pCS2-FLAG vector obtained from Addgene (Cambridge, MA). Cell lines were routinely tested for mycoplasma ...
-
bioRxiv - Biophysics 2019Quote: ... an N-terminal LCTPSR FGE recognition motif on Cas1 was inserted by site-directed mutagenesis in plasmid pWUR871 with primers in Table S1 and co-expressed with FGE proteins (Addgene, plasmid #16132) (Carrico et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... and amplified ZBP1 cDNA using forward: GGGAATTCATGGCCCAGGCTCCTGCT and reverse: TAGCGGCCGCCTAAATCCCACCTCCCCA primers from pEGFPN.1 vector cloned into LeGO-iG2-IRES-EGFP vector (Addgene plasmid #27341) between EcoRI and NotI sites followed by 5x strep-tag II (TGGAGCCATCCGCAGTTTGAAAAA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The fragment has been amplified using the primers F-5’-TGCAGGATCCCATCGATTCGGCCACCATGAAACGGACAG -3’ and R-5’-TAGAGGCTCGAGAGGCCTTGTCAGACTTTCCTCTTCTTCTTGG -3’) from the pCAG-CBE4max-SpG-P2A-EGFP plasmid (Addgene plasmid #139998)14 and from the pCAG-CBE4max-SpRY-P2A-EGFP plasmid (Addgene plasmid #139999)14.
-
bioRxiv - Cell Biology 2023Quote: ... with N-terminal HA tag added into primers followed by insertion into NotI/EcoRI-linearized pGCGFP-G418 (a gift from Andrew Pierce, Addgene plasmid #31264) using In-Fusion HD (Takara Bio) ...
-
bioRxiv - Developmental Biology 2023Quote: Riboprobes for in situ hybridization were synthesized using the oligonucleotide primers listed in Supplementary Table 4 to clone the DNA fragment of interest into vector pJC53.2 (Addgene Plasmid ID: 26536), followed by riboprobe synthesis previously described 80.
-
bioRxiv - Developmental Biology 2023Quote: Gene fragments were amplified from cDNA using oligonucleotide primers listed in Table S3 and cloned into the vector pJC53.2 (Addgene Plasmid ID: 26536) (Collins et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The individual ORFs were then amplified by PCR using primers ZJ6-ZJ10 (Table S2) and cloned individually into a pLEW100v5 vector (pLEW100v5 was a gift from George Cross; Addgene plasmid # 24011) using Gibson assembly ...
-
bioRxiv - Bioengineering 2024Quote: ... with primers BW-NH-710 and BW-NH-711 while pTol2Dest was constructed by amplification of pT2/HE (Addgene Plasmid ID: 26557) with BW-NH-792 and BW-NH-793 ...
-
bioRxiv - Genetics 2023Quote: ... by performing gibson assembly with the TRE3G promoter and P2A-BFP-WPRE amplified from TRE-KRAB-dCas9-IRES-BFP (addgene #85449) combined with nCas9(H840A)-MMLV(RT) amplified from pLenti-Synapsin-hChR2(H134R)-EYFP-WPRE (Addgene# 20945) and 7.3Kb (lentiviral backbone ...
-
bioRxiv - Cell Biology 2020Quote: ... We PCR amplified d2EGFP from M38 TOP-dGFP (Addgene #17114), engineering XhoI and NotI sites using primer sequences 5’-AAACTCGAG-GCCACCATGGTGAGCAAGG and 5’-AAAGCGGC-CGCCTACACATTGATCCTAGCAGAAG and cloned the coding region upstream of the β-globin-UTR ...
-
bioRxiv - Microbiology 2021Quote: ... The resulting PCR product was then subcloned into pcDNA3.1+ (Addgene) using BamHI and NotI restriction endonucleases (pcDNA3.1+-KanSacB).
-
bioRxiv - Developmental Biology 2021Quote: Kaede PCR product was amplified from the plasmid (Addgene #54726) for generating the template for capped mRNA synthesis (primers F ...
-
bioRxiv - Microbiology 2021Quote: ... were PCR amplified and inserted into the plasmid pFGL1010 (Addgene, 119081 ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR amplified and cloned into lentiGuide-Puro vector (Addgene #52963). Briefly ...
-
bioRxiv - Microbiology 2020Quote: ... the gene encoding mRFPmars was PCR amplified from pmRFPmars (Addgene) with primers 4572/4573 ...
-
bioRxiv - Cell Biology 2022Quote: Mouse Drp1 was PCR amplified from pcDNA3.1 mDrp1 (Addgene #34706) and cloned into pLenti BlastR using InFusion cloning ...
-
bioRxiv - Microbiology 2021Quote: ... the gene encoding mRFPmars was PCR amplified from pmRFPmars (Addgene) with primers 4572/4573 ...
-
bioRxiv - Genomics 2021Quote: ... KRAB and dCas9 were PCR amplified from pCC_09 (Addgene 139094) (69 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and PUM2 was PCR amplified from pMAL-PUM2 (Addgene #120385). For PUM1 plasmids ...
-
bioRxiv - Cancer Biology 2022Quote: CreERt2 was amplified by PCR using pCGA_creERt2 (Addgene plasmid #14797) as template ...
-
bioRxiv - Cell Biology 2022Quote: ... jGCaMP7s was PCR amplified from pGP-CMV-jGCaMP7s (Addgene #104463). Following gel extraction ...
-
bioRxiv - Cell Biology 2022Quote: ... sgDNA was first PCR-amplified from pDD162 vector (Addgene 47549) using primers targeting the SWIP sequence ...
-
bioRxiv - Physiology 2022Quote: ... TBG promoter was PCR-cloned from the pAAV.TBG.PI.eGFP.WPRE.bGH (Addgene #105535) using primers with XbaI cloning site (5’-GGTTCTAGATGCATGTATAATTTCTACAG ...
-
bioRxiv - Microbiology 2022Quote: ... cpGFP was PCR-amplified from pTKEI-Tre-C04 34 (Addgene plasmid #79754 ...
-
bioRxiv - Neuroscience 2022Quote: ... we first PCR amplified mGreenLantern from pcDNA3.1-mGreenLantern (Addgene #161912). Using MluI and XbaI ...
-
bioRxiv - Systems Biology 2024Quote: ... was created by PCR cloning of IKK2-EE (Addgene, 11105) with BclI–MfeI ends and inserting into pBABE puro (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR product was placed in pME (pDONR221 #398, Addgene) using a Gateway recombination reaction with BP clonase II ...
-
bioRxiv - Cancer Biology 2023Quote: ... GFP was amplified by PCR from pLeGO-iG2 (Addgene #27341). The IRES site was amplified by PCR from pInducer-21 (Addgene #46948) ...