Labshake search
Citations for Addgene :
101 - 150 of 1062 citations for hsa mir 150 3p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... as template and the following primers was cloned into pX458 (Addgene # 48138) at the AgeI FseI sites.
-
bioRxiv - Neuroscience 2021Quote: ... a gfp PCR product was PCR amplified from pPD95.75 (Addgene) using primers containing 35bp of overlap with the spop-1 gene immediately upstream of the predicted nuclear localization sequence ...
-
bioRxiv - Immunology 2022Quote: ... and HM13 (Table S2) were selected from a previously published set (26) and inserted into pspgRNA (Addgene plasmid # 47108 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3.7mm DV from lambda) and 150 nL AAVretro-Ef1a-Cre (Salk vector core, Addgene #55637) into either left zona incerta (–2.03 mm AP ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The corresponding primers were cloned into the sgRNA expression cassette of pGREB31 (Addgene). The pTGE2 vector was constructed as described above based on target site sequence 12 (Figure 1B ...
-
bioRxiv - Bioengineering 2024Quote: ... pFA6a-link-yoEGFP-SpHis5 (primers OM-8 and OM-9) (Addgene plasmid #44836), and pBTK522::FAST-PETase 21 (gift from Hal Alper ...
-
bioRxiv - Neuroscience 2023Quote: ... 150-200nl of Cre- and Flp-dependent virus AAV8-hSyn-Con/Fon-EYFP (Addgene #55650-AAV8) was unilaterally injected into the MPN (AP 0 ...
-
bioRxiv - Cell Biology 2021Quote: ... gRNA primers were individually ligated into a variant of the pX335 vector (Addgene #42335) additionally containing the reporter protein GFP and a puromycin selection cassette (Cong et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a 10xUAS promoter fragment amplified with primers 1010.C3 and 1010.C4 from Addgene plasmid 78897 ...
-
Role of the Topoisomerase IIα Chromatin Tether domain in Nucleosome Binding & Chromosome SegregationbioRxiv - Cell Biology 2021Quote: ... The synthesized oligo DNA primers for the guides were inserted into pX330 (Addgene #42230). For Tet-inducible expression of exogenous TopoII ...
-
bioRxiv - Molecular Biology 2022Quote: ... was amplified using primers casI.for and casv.rev2 and introduced into SwaI-opened pBig1b (Addgene) by Gibson assembly ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then transduced with the Calabrese Human CRISPR Activation Pooled Library (Set A, Addgene, 92379-LV) using enough cells to obtain a library coverage of 500 cells per sgRNA at an MOI of 0.4.17 Selection with puromycin (0.6 μg/ml ...
-
bioRxiv - Biochemistry 2021Quote: A 20 μL reaction containing 150 ng of a plasmid containing two loxP sites (Addgene Plasmid #26852) and 500 nM of Cre or Cre mutants in recombination buffer (50 mM Tris-Cl ...
-
bioRxiv - Neuroscience 2023Quote: ... and 150-250 nL of AAV5-EF1α-DIO-hChR2(H134R)-mCherry (5.25 x 1012 GC/ml, RRID:Addgene_20297), AAV5-EF1α-DIO-mCherry (7.3 x 1012 GC/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... to induce expression of Voltron2-ST and a 1:150 dilution of AAV9-hSyn-Cheriff-EGFP (Addgene plasmid #51697 ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1-1.5μl of Forward and Reverse primers and 50ng of lenti-sgRNA plasmid (Addgene; 52963) in a 50μl total volume reaction ...
-
bioRxiv - Plant Biology 2022Quote: ... Primers GFP-F-EcoRI and 3xNLS-R were used to obtain GFP-3xNLS from Addgene plasmid pEGFP-C1 EGFP-3xNLS ...
-
bioRxiv - Cancer Biology 2021Quote: ... MSCV EZH2 ΔSET-Hygro (cat# 49403) EZH2-Y641-F (cat# 80077) and pTRIPZ M)-YFP-EZH2 (cat# 82511) were procured from Addgene USA ...
-
bioRxiv - Genomics 2021Quote: ... one set of cells received a lentivirus expressing the Cre recombinase under the control of the hSyn1 promoter (Addgene 86641). This induced expression of the dCas9p300 transgene in the neurons ...
-
bioRxiv - Cell Biology 2021Quote: Using the Neon transfection system pre-set program #16 (1400V, 20ms, 3 pulses) plasmids used for reprogramming (available from Addgene) were EN2L ...
-
bioRxiv - Biochemistry 2024Quote: ... Step one assembly reactions were set up to obtain the vectors pACEBac1-POMP-PAC1-PAC2-PAC3-PAC4 (Addgene plasmid #XXXX), pACEBac1-PSMA1-PSMA2-PSMA3-PSMA4 ...
-
bioRxiv - Microbiology 2019Quote: ... pCR-BluntII-TOPO (Addgene #41824) (29) ...
-
bioRxiv - Neuroscience 2019Quote: ... 120 to 150 nl of AAV1.hSynap.SF-iGluSnFR.A184S.WPRE.SV40 (HHMI Janelia Research Campus and Addgene, titer 2.7e13 GC/ml) were pressure-injected at a depth of approximately 350 μm ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... by high fidelity Q5 polymerase PCR using primer set given table-1 and cloned purified hACE2 gene fragment into NheI and BamHI digested fragment of pLenti backbone (Addgene, 112675) by Gibbson assembly ...
-
bioRxiv - Cancer Biology 2023Quote: Two sets of gRNAs targeting either exon 3 or exon3-7 of IL1R1 coding region were cloned in PX459 (Addgene 62988) and co-transfected in HT1080 cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Reverse primer NT: 5’-CGGGATCCCTATTGAGTTCTTTTGTGCTC-3’) and cloned into the mApple-C1 vector (Addgene plasmid # 54631) using the XhoI and BamHI restriction sites ...
-
bioRxiv - Neuroscience 2022Quote: ... and primers AJ20122 – AJ20116 and AJ20117 – AJ20121 with pORANGE empty (Addgene #131471, Willems et al., 2020) as template ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Mutations were introduced using the same primers on BcLOV4-ITSN1 (Provided by Brian Chow) (Addgene #174509) to generate meltITSN1-37 ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplified HGS or VPS37A from U937 cDNA and PCR amplified mScarlet from pmScarlet_C1 (Addgene #85042) into pTRIP-SFFV-EGFP-NLS (Addgene #86677) ...
-
bioRxiv - Molecular Biology 2022Quote: PCR fragment with pY010 (Addgene #69982) as template and the following primers was cloned into pX458 (Addgene # 48138 ...
-
bioRxiv - Genetics 2022Quote: ... which we PCR amplified from Addgene plasmid #67639 ...
-
bioRxiv - Genetics 2022Quote: ... we PCR amplified NatMX from Addgene plasmid #35121 with the primers listed in Supplementary Table 6 using Phusion Hot Start Flex DNA polymerase (NEB) ...
-
bioRxiv - Biophysics 2024Quote: ... emiRFP670 were PCR amplified from Addgene Plasmid #136571 (Matlashov et al. ...
-
2P-NucTag: on-demand phototagging for molecular analysis of functionally identified cortical neuronsbioRxiv - Neuroscience 2024Quote: ... GCaMP7f was PCR-amplified from Addgene plasmid #104492 with a 3’ Primer that contained sequences encoding four Alanine residues and the 2PA sequence (both in frame with the coding sequence of GCaMP7f) ...
-
bioRxiv - Cell Biology 2023Quote: ... and pCR-24xPP7SL (Addgene, Cat.No. 31864) plasmids were double digested using SpeI and NotI restriction enzymes and the 24xMS2SL (1352bp ...
-
bioRxiv - Neuroscience 2022Quote: Ucn3-cre animals were injected with a cocktail of 150 nL of AAV-syn-jGCaMP7f-WPRE (Addgene 104488-AAV9) and 225 nL of AAV-hSyn-DIO-hM4D(Gi)-mCherry into PeFA (ML ...
-
bioRxiv - Neuroscience 2023Quote: ... LepR-Cre mice were stereotaxically injected with 150-200 nL of AAV1-CAG-Flex-GCaMP6s-WPRE-SV40 (6.1 × 1012 titer; Addgene) unilaterally into the left DMH (AP ...
-
bioRxiv - Genetics 2022Quote: ... test set variants and libraries were cloned into pAG416GPD-EGFP-ccdB (Addgene plasmid # 14316 ; http://n2t.net/addgene:14316 ; RRID:Addgene_14316, (Alberti et al., 2007)) using Gateway cloning (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primers for individual sgRNAs were annealed and cloned into the lenti-sgRNA(MS2)_zeo backbone (Addgene #61427) using the Golden Gate cloning reaction into the BsmBI site (For primers sequences see Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2021Quote: ... primers with AflII restriction sites were used to amplify sgRNA cassette from the PX458 plasmid (Addgene 48138) [21] ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157) plasmid as template DNA respectively.
-
bioRxiv - Neuroscience 2020Quote: ... amplified with a pair of primers: CCGCGAAGATCTATGAGTAAAGGAGAAGAACTTTTCAC and GGCAGTCGACCTGCAGCCGCGGCCGTTTGTATAGTTCATCCATGCCATG into pDisplay-mSA-EGFP-TM (Addgene plasmid #39863) (Lim et al. ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... 51 using primers #477_R18A01_Left_primer GCTTAGCCAGATTGTTGGATGCCTG and #478_R18A01_Right_primer GCGTTATGAGGTTGTGCTGCAGATC and cloning it into pBPLexA::p65Uw [a gift from Gerald Rubin (Addgene plasmid # 26231 ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VP64 fragment amplified from Addgene plasmid #78897 22 with primers 986.C17 and 986.C18 to generate plasmid OA-986D (Addgene #125001); and the bottleneck promoter fragment amplified with primers 986.C13 and 986.C19 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VPR fragment amplified from Addgene plasmid #78898 22 with primers 986.C15 and 986.C12 to generate plasmid OA-986C (Addgene #125000); the Ubiquitin-63E promoter fragment amplified with primers 986.C9 and 986.C16 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VPR fragment amplified from Addgene plasmid #78898 22 with primers 986.C11 and 986.C12 to generate plasmid OA-986B (Addgene #124999); the bottleneck promoter fragment amplified with primers 986.C13 and 986.C14 from D ...
-
bioRxiv - Bioengineering 2020Quote: ... melanogaster genomic DNA and a dCas9-VP64 fragment amplified from Addgene plasmid #78897 22 with primers 986.C20 and 986.C18 to generate plasmid OA-986E (Addgene #125002).
-
bioRxiv - Synthetic Biology 2022Quote: ... was PCR amplified with NEB Q5 High-Fidelity 2X Master Mix (M0492) using primers 1157_onestep_p1 and 1157_onestep_p2. PRExpress (Akmammedov et al. 2017) was obtained from Addgene (122486). The PRE repeats of PRExpress were removed using Kpn-I and Nhe-I and purified using Zymoclean Gel DNA Recovery Kit (Genesee Scientific #11-301) ...
-
bioRxiv - Microbiology 2023Quote: ... reverse primer: 5’ – GAGTCGggatccACTAGTAGTTCCTGCTATGTCACTTCCCCTTGG – 3’) and ligating the domain into the pUC19 cloning vector (Addgene plasmid # 50005), using the T4 ligase ligation kit (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... and hTATSF1 (amplified from K562 cDNA prepared using oligo(dT) primers) ORFs respectively into pLIX_403 (Addgene # 41395). Viral preps and selection were done as in previous section ...