Labshake search
Citations for Addgene :
251 - 300 of 552 citations for DNA Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... the DNA plasmids were respectively derived from the plasmids pAAV:EF1α:DIO:ChETA-eYFP (plasmid #26968; Addgene, Watertown, MA, USA) and pAAV:EF1α:DIO:eYFP (Addgene plasmid #27056 ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing GA50 was amplified from pAG303-Gal-GA50 (Addgene # 84907; (Jovičič et al., 2015)) and a DNA fragment containing GFP were inserted into pCAGEN by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Cell Biology 2022Quote: ... WT and FIP200 KO HeLa cells were cotransfected with the DNA fragment and the PX459 (Addgene #48139)-based plasmid expressing Cas9 and gRNA (GTCTTAGAAGCCGTGAGGTA for the NCOA4 gene ...
-
bioRxiv - Genomics 2020Quote: ... The resulting DNA fragments were cloned into the linearized STARR-seq vector (Addgene #71509, AgeI-SalI digested) using the In-Fusion HD kit (Takara) ...
-
bioRxiv - Cell Biology 2020Quote: ... plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157) plasmid as template DNA respectively.
-
bioRxiv - Neuroscience 2021Quote: ... WT and mutant forms of syt1 DNA were subcloned into a FUGW transfer plasmid (Addgene plasmid # 14883) modified with a synapsin promoter and an IRES-expressed soluble GFP marker ...
-
bioRxiv - Microbiology 2021Quote: ... marinum genomic DNA and cloned in-frame into the SspI site of 6XHis-MBP-TEV (AddGene: 29656). Plasmids were freshly transformed into the E ...
-
bioRxiv - Molecular Biology 2022Quote: ... The resulting DNA fragment containing two MpU6promoter-gRNA cassettes was transferred into pMpGE010 (cat. no. 71536, Addgene) (Sugano et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... a FoxO1 plasmid encoding a deleted DNA binding domain (amino acid 208-220) was used (Addgene #10694). After 24 hours ...
-
bioRxiv - Neuroscience 2019Quote: ... the DNA cassette encoding KASH-tagged EGFP (EGFPKASH) (16) was amplified from the PX552 plasmid (Addgene #60958) by Phusion High-Fidelity DNA polymerase ...
-
bioRxiv - Developmental Biology 2022Quote: ... and the synthesised DNA fragments were subcloned into the BbsI sites of the pX459 vector (#62988, Addgene). The resulting constructs were transfected into ES cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding heteronu-clear ribonucleoprotein A1 (hnRNPA1) was amplified from pET9d-hnRNP-A1 (#23026, Addgene) using PCR and inserted into mCherry-C1 (pmCherry-hnRNPA1) ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection was performed using 1100 ng of total DNA (500 ng transfer plasmid, 500 ng pCMVR8.74 Addgene plasmid # 22036 ...
-
bioRxiv - Cancer Biology 2023Quote: ... EF.deltaBHES1.Ubc.GFP (DBD-HES1 DNA-binding domain mutant of HES1; #24982) were obtained from Addgene (Cambridge, USA). The reporter plasmids containing the firefly luciferase gene under the control of various fragments of the Hes1 promoter (2.5 kb ...
-
bioRxiv - Biochemistry 2023Quote: ... DNA oligos containing guide RNA (gRNA) sequences were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene, #42230). The oligos were phosphorylated with T4 PNK (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lentiviral particles were generated by co-transfecting 1.5 µg of total DNA of pMDLg/pRRE (Addgene #12251), pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Bioengineering 2023Quote: ... The amplified gRNA plasmid DNA was co-transfected into HEK 293T cells with psPAX2 (Addgene, plasmid #12260) and pMD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: DNA fragments coding for full-length human Deltex1 (1863bps) was inserted into the pcDNA3.1-HA (Addgene #128034) mammalian expression vector with an N-terminal HA tag ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid kit used for the generation of TALENs was a gift of Daniel Voytas and Adam Bogdanove (Addgene kit #1000000016). Plasmid encoding assembled TALENs was linearized with SacI ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP tagged OsHIPP19 and OsHIPP20 were generated by Golden Gate methods (Engler et al. 2008) using MoClo Plant Parts Kit and MoClo Plant Tool Kit (Addgene, UK). OsHIPP19 and OsHIPP20 were cloned into pICH47732 with a GFP tag at the N-terminus ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Cell Biology 2023Quote: ... were constructed in according to Golden Gate TALEN assembly protocol and using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene, Kit #1000000024). CIscript-GoldyTALEN was a gift from Daniel Carlson & Stephen Ekker (Addgene ...
-
bioRxiv - Plant Biology 2024Quote: ... Plasmid construction was performed by modular cloning using the MoClo Tool Kit and the MoClo Plant Parts Kit (Addgene, 28–30). A detailed MoClo protocol and the list of vectors used can be found in 18.
-
bioRxiv - Biochemistry 2024Quote: Plasmids encoding GPCRs were obtained from various sources (as indicated Key Resources Table) or subcloned into pcDNA3.1 from the PRESTO-Tango GPCR kit (Addgene Kit #1000000068) as described next ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA sequences between nucleotides 1-3877 and 4236-4617 were PCR amplified from V5-GFP-P180 (Addgene #92150) and the two fragments were assembled and cloned into pEGFP(A206K)-N1 between XhoI and BamHI sites by GIBSON assembly ...
-
Integrated requirement of non-specific and sequence-specific DNA binding in MYC-driven transcriptionbioRxiv - Molecular Biology 2020Quote: ... sequences to target the MYC gene in the proximity of the BR-coding region were designed using the online software CRISPR Design Tool (http://crispr.mit.edu/) and cloned as DNA inserts into pSpCas9 (BB)-2A-GFP (PX458) (Addgene plasmid # 48138 ...
-
bioRxiv - Molecular Biology 2019Quote: A DNA fragment containing HTT103Q-GFP was amplified from p426 103Q GPD (Addgene #1184; (Krobitsch and Lindquist, 2000)) and inserted into pCAGEN by NEBuilder HiFi DNA Assembly Master Mix (NEB).
-
bioRxiv - Genomics 2022Quote: ... Per transfection reaction we used 7.5ul of 1 mg/mL polyethyleneimine (PEI) and 2.325 μg of total plasmid DNA (825 ng psPAX2: Addgene #12260 ...
-
bioRxiv - Cell Biology 2019Quote: ... A DNA fragment encoding APEX2 was amplified from pcDNA3-APEX2-NES (gift from Alice Ting, Addgene plasmid # 49386) using primers GL3N2-APEX2 (5’-ggaggttctggtggtggtGCGGCCGCcGGAAAGTCTTACCCAACTGTGA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... DNA oligos (IDT) containing sgRNA sequences were annealed and ligated into pX458 (Addgene, #48138, gift from Feng Zhang). Cells were transfected with pX458 constructs using Mirus TransIT-X2 (Mirus Bio ...
-
bioRxiv - Genomics 2021Quote: ... gRNA sequences were designed with chopchop (https://chopchop.cbu.uib.no) and corresponding DNA oligonucleotides containing BsmBI overhangs were annealed and ligated with lentiCRISPR v2 plasmid (Addgene, # 52961), which contains both Cas9 and sgRNA sequences55 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of mDrp1-P2A (a gift from David Chan (Addgene plasmid # 34706; http://n2t.net/addgene:34706; RRID:Addgene_34706), P2A sequence in C-terminal ...
-
bioRxiv - Cell Biology 2020Quote: ... Amplicons were treated with DpnI to degrade genomic DNA and ligated into the digested p416 GPD plasmid (Addgene). Cloning products were then transformed into E ...
-
bioRxiv - Biochemistry 2022Quote: ... Lentivirus was generated by transfection of HEK293T cells with expression construct plasmid DNA with pMDLg/pRRE (Addgene, 12251), pRSV-Rev ...
-
bioRxiv - Genetics 2022Quote: ... we transformed BY with a DNA fragment created by PCR amplifying the NatMX cassette from plasmid from Addgene plasmid #35121 (a gift from John McCusker ...
-
bioRxiv - Immunology 2021Quote: ... was amplified from hCD4-mOrange plasmid DNA (hCD4-mOrange was a gift from Sergi Padilla Parra; addgene plasmid #110192; http://n2t.net/addgene:110192; RRID:Addgene_110192) by PCR using forward primer hCD4 fwd and reverse primer hCD4 rev and introduced into BamHI and XhoI sites of a pcDNA3.1 vector variant (pcDNA3.1(+)IRES GFP ...
-
bioRxiv - Neuroscience 2022Quote: Neuronal transfection with the DNA construct pHR hsyn:EGFP (Keaveney et al., 2018; kind gift from Xue Han (Addgene plasmid # 114215 ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of mMff-P2A (a gift from David Chan (Addgene plasmid # 44601; http://n2t.net/addgene:44601; RRID:Addgene_44601), P2A sequence in C-terminal ...
-
bioRxiv - Neuroscience 2020Quote: ... DNA fragment of DIO-EGFP (a gift from Bernardo Sabatini (Addgene plasmid # 37084; http://n2t.net/addgene:37084; RRID:Addgene_37084)) was transferred to CAG promoter containing lentiviral plasmid backbone by restriction digestion and ligation to obtain a pLenti-CAG-DIO-GFP-WPRE ...
-
bioRxiv - Cell Biology 2021Quote: Gibson Assembly (Gibson et al., 2009) was performed with three DNA fragments: (1) linearized pPtPBR1 episome backbone (Addgene, Cambridge ...
-
bioRxiv - Cell Biology 2021Quote: ... HeLa R19 cells stably expressing mCherry-EGFP-LC3 were obtained through stable transfection of plasmid DNA (Addgene #22418), followed by puromycin selection and generation of monoclonal cell populations by limited dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were transfected with 1 ug total DNA (0.5 ug PCR product and 0.5 ug AsCpf1_TATV Cas12 [Addgene: 89354]) using Xtreme-GENE 9 following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 μg of total plasmid DNA/well were used in appropriate combinations of the plasmids: pLVX-puro (Addgene), pLVX-puro-TRIM67-Flag ...
-
bioRxiv - Immunology 2021Quote: ... gRNAs were purchased from Integrated DNA Technologies (Coralville, IA) and cloned into the pX335 plasmid (Addgene, plasmid #42335) encoding genetically modified Cas9 endonuclease which generates nicks ...
-
bioRxiv - Developmental Biology 2022Quote: ... plasmid DNA (5 ng/μl) and Tol2 transposase mRNA(4 ng/μl) (synthesized from pT3TS-Tol2 Addgene #31831) were injected into one-cell stage embryos ...
-
bioRxiv - Cell Biology 2022Quote: The sqh_GFP_FRB_donor plasmid was generated by inserting synthesized DNA between the two EcoRI sites of ScarlessDsRed_pHD-2xHA (a gift from Kate O’Connor-Giles, Addgene plasmid # 80822 ...
-
bioRxiv - Cell Biology 2022Quote: ... Total plasmid DNA was made up in equal parts of each expression vector and pAcGFP1-C1 vector (Addgene) (a GFP reporter plasmid ...
-
bioRxiv - Genomics 2022Quote: ... 5 μg DNA was incubated with1.75 μg pMD2.G and 3.25 μg pCMV-dR8.91 (Addgene, Watertown, MA; #12259). On the next day ...
-
bioRxiv - Molecular Biology 2023Quote: ... sense and antisense DNA oligos were annealed and ligated into a BsmbI digested LRG2.1 expressing GFP (Addgene: 108098).
-
bioRxiv - Neuroscience 2022Quote: Neuronal transfection with the DNA construct pHR hsyn:EGFP (Keaveney et al., 2018; kind gift from Xue Han (Addgene plasmid #114215 ...